Supercharge Your Innovation With Domain-Expert AI Agents!

Adenovirus vector vaccine for preventing SARS-CoV-2 Ombucker strain

An adenovirus and vaccine technology, applied in the field of biomedicine, can solve the problems of weakening the immune protection effect of vaccines, easy escape neutralization, and invalid potency of vaccines

Active Publication Date: 2022-03-08
GUANGZHOU N BIOMED LTD
View PDF33 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Moreover, the S gene of the Omicron mutant strain has at least 27 mutations. The existing vaccines have very poor immune protection effect on the Omicron mutant strain, and it is very easy to escape the neutralizing effect of the existing vaccine neutralizing antibody. Greatly weakens the immune protection of current vaccines and tends to replace Delta mutants
The vaccines currently on the market are inactivated vaccines, subunit protein vaccines, mRNA vaccines and adenovirus vector vaccines. These vaccines are mainly aimed at the original strain of SARS-CoV-2, and their protective effects against the mutant strain of Omicron are all reduced. None of them can achieve a very ideal immune effect on the Omicron strain after immunization
In addition, the expression level of the natural spike protein S gene of SARS-CoV-2 is very low in human kidney cell HEK293, so if the original S codon of the SARS-CoV-2 Omicron strain is used as an antigen, its SARS -The original S gene sequence protein of the CoV-2 Omicron strain cannot be effectively and efficiently expressed in cells, and its vaccine may be ineffective or the potency is very low, which is not enough to resist virus infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adenovirus vector vaccine for preventing SARS-CoV-2 Ombucker strain
  • Adenovirus vector vaccine for preventing SARS-CoV-2 Ombucker strain
  • Adenovirus vector vaccine for preventing SARS-CoV-2 Ombucker strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Analysis of Spike gene codon optimization effect

[0063] 1. Construction of the shuttle plasmid pGA1-S50 of the S gene of the Omicron mutant strain

[0064] Using pcDNA3.1-S50 (synthesized by Nanjing GenScript Biotechnology Co., Ltd., S50 is SEQ ID NO: 2) plasmid as template, S50-F and S50-R as primers, using Primer Star Mix (TaKaRa) PCR The target fragment S50 was amplified.

[0065] S50 amplification primer sequence:

[0066] S50-F: gtaccgagctcggatccgccaccatgttcgtgttcctggtcctactgcc (SEQ ID NO: 3);

[0067] S50-R: agaatagggccctctagactagtttatcaggtgtagtgcagcttt (SEQ ID NO: 4).

[0068] PCR program: 98°C for 3min; 98°C for 10 s, 60°C for 5 s, 72°C for 30 s, 28 cycles; 72°C for 5min, and store at 4°C.

[0069] Using the PGA1-EGFP plasmid (preserved by Guangzhou Enbao Biomedical Technology Co., Ltd.) as a template and CMV-R and BGH-F as primers, the target fragment PGA1 was amplified by PCR using Primer Star Mix (TaKaRa).

[0070] pGA1 Backbone Amplification...

Embodiment 2

[0098] Example 2 Construction of the S antigen vector pAd5-S50 carrying the Omicron mutant strain

[0099] 1. Construction of the shuttle plasmid pGA1-S50 of the S gene of the Omicron mutant strain

[0100] Using pcDNA3.1-S50 (synthesized by Nanjing GenScript Biotechnology Co., Ltd., S50 is SEQ ID NO: 2) plasmid as a template, S50-F (SEQ ID NO: 3) and S50-R (SEQ ID NO: :4) is used as primers, using Primer Star Mix (TaKaRa) to amplify the target fragment S50 by PCR.

[0101] PCR program: 98°C for 3min; 98°C for 10 s, 60°C for 5 s, 72°C for 30 s, 28 cycles; 72°C for 5min, and store at 4°C.

[0102] Using the PGA1-EGFP plasmid (carrying the homologous recombination arm plasmid in the Ad5E1 region, preserved by Guangzhou Enbao Biomedical Technology Co., Ltd.) as a template, CMV-R (SEQ ID NO: 5) and BGH-F (SEQ ID NO: 6 ) as primers, the target fragment PGA1 was amplified by PCR using PrimerStar Mix (TaKaRa).

[0103] PCR program: 98°C for 3min; 98°C for 10 s, 60°C for 5 s, 72°C ...

Embodiment 3

[0114] Example 3 Construction of the S antigen vector pAd35-S50 carrying the Omicron mutant strain

[0115] 1. Construction of the shuttle plasmid pGA351-S50 of the S gene of the Omicron mutant strain

[0116] Using pcDNA3.1-S50 (synthesized by Nanjing GenScript Biotechnology Co., Ltd., S50 is SEQ ID NO: 2) plasmid as a template, S50-F (SEQ ID NO: 3) and S50-R (SEQ ID NO: :4) is used as primers, using Primer Star Mix (TaKaRa) to amplify the target fragment S50 by PCR.

[0117] PCR program: 98°C for 3min; 98°C for 10 s, 60°C for 5 s, 72°C for 30 s, 28 cycles; 72°C for 5min, and store at 4°C.

[0118] Using the PGA351-EGFP plasmid (carrying the homologous recombination arm plasmid in the Ad35E1 region, preserved by Guangzhou Enbao Biomedical Technology Co., Ltd.) as a template, using CMV-R (SEQ ID NO: 5) and BGH-F (SEQ ID NO: 6 ) as primers, the target fragment PGA351 was amplified by PCR using PrimerStar Mix (TaKaRa).

[0119] PCR program: 98°C for 3min; 98°C for 10 s, 60°C ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to an adenovirus vector vaccine for the prevention of an SARS-CoV-2 Ombke strain. According to the present invention, codon preference is adopted to optimize to obtain the new S gene sequence, and the new S gene sequence can be efficiently expressed in human cells, can efficiently express the S antigen after immunizing the body, can produce the neutralizing antibody aiming at the Ombucus chinensis strain SARS-CoV-2, and can effectively protect the body from the infection of the Ombucus chinensis strain.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to an adenovirus vector vaccine used to prevent the SARS-CoV-2 Omicron strain. Background technique [0002] In the face of the new crown pneumonia epidemic, prevention and blocking the spread of the virus are the key to controlling the epidemic. Vaccines are the most cost-effective interventions to prevent and control 2019-nCoV infection. In the virus particle structure of SARS-CoV-2 coronavirus, the S-protein that makes up the "crown" is an obvious target and has become the focus of most research teams. A research team has successfully revealed the relationship between the S protein and its receptor ACE2 in the process of invading cells through computer simulation of the three-dimensional structure of the S protein. Therefore, the S protein plays an important role in mediating the binding of virions to host cell receptors and in inducing neutralizing antibodies. According t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/50C12N15/861A61K39/215A61P31/14G01N33/68G01N33/569
CPCC07K14/005C12N15/86A61K39/12A61P31/14G01N33/6854G01N33/56983C12N2770/20022C12N2710/10343C12N2800/107C12N2800/22C12N2770/20034A61K2039/5256A61K2039/53G01N2333/165G01N2469/20
Inventor 陈凌杨臣臣汪乾关素华
Owner GUANGZHOU N BIOMED LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More