DNA (deoxyribonucleic acid) sequence used for circular RNA (ribonucleic acid) expression, expression vector and applications of DNA sequence and expression vector
A DNA sequence and vector technology, applied in recombinant DNA technology, DNA/RNA fragments, introduction of foreign genetic material using vectors, etc., can solve the problems of low success rate, long experiment period, and difficult experiment, and achieve stable results and operation. easy effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1: Construction of pcDNA-circRNA1730 overexpression plasmid
[0052] 1. Primer design:
[0053] Download the linear sequence of the hsa_circ_0001730 circular RNA from the CircBase database:
[0054] >hsa_circ_0001730|NM_004444|EPHB4
[0055] GTACTAAGGTCTACATCGACCCCTTCACTTATGAAGACCCTAATGAGGCTGTGAGGGAATTTGCAAAAGAGATCGATGTCTCCTACGTCAAGATTGAAGAGGTGATTGGTGCAGGTGAGTTTGGCGAGGTGTGCCGGGGGCGGCTCAAGGCCCCAGGGAAGAAGGAGAGCTGTGTGGCAATCAAGACCCTGAAGGGTGGCTACACGGAGCGGCAGCGGCGTGAGTTTCTGAGCGAGGCCTCCATCATGGGCCAGTTCGAGCACCCCAATATCATCCGCCTGGAGGGCGTGGTCACCAACAGCATGCCCGTCATGATTCTCACAGAGTTCATGGAGAACGGCGCCCTGGACTCCTTCCTGCGG
[0056] Primer design with Primer5 software:
[0057] circRNA1730-F: 5'GGGGTACCGTACTAAGGTCTACATCGACCCCTT3'
[0058] circRNA1730-R: 5'GCTCTAGACCGCAGGAAGGAGTCCAG3'
[0059] The primer sequences were synthesized by Shanghai Jierui Company.
[0060] 2. PCR catch gene:
[0061] PCR reaction system, total 50ul:
[0062] 2mMdNTP5ul
[0063] 10×KODbuffer5ul
[0064] ...
Embodiment 2
[0157] Example 2: Construction of pLL-circRNA1730 lentivirus and its stable cell line
[0158] 1. Lentiviral packaging
[0159] 1) 24 hours before transfection, 293T cells in the logarithmic growth phase were digested with trypsin, passaged to a 10 cm cell culture dish, and cultured in a 37°C, 5% CO2 incubator. After 24 hours, when the cell density reaches 70%-80%, it can be used for transfection. Cell state is critical for virus packaging, so good cell state and low passage times need to be guaranteed.
[0160] 2) Replace the cell culture medium with serum-free medium before transfection.
[0161] 3) Add the prepared DNA solutions (10 μg of pLL-circRNA1730 vector, 5 μg of pGag / Pol vector, 5 μg of pRev vector, and 5 μg of pVSV-G vector) into a sterilized centrifuge tube, and mix with the corresponding volume of Opti-MEM evenly, Adjust the total volume to 1.5ml.
[0162] 4) Shake Lipofectamine2000 reagent gently, take 60 μl Lipofectamine2000 reagent and mix with 1.5ml Opti-...
Embodiment 3
[0183] Embodiment three: QPCR detection
[0184] 1. RNA extraction
[0185] 1) Cell treatment: Add 1ml Trizol to each well of a 6-well plate, pipette repeatedly 10 times with a 1ml pipette tip, collect into an EP tube; centrifuge for 15 minutes at 12000g, and take the supernatant.
[0186] 2) Add 200ul chloroform to the supernatant, mix vigorously up and down for half a minute, and let stand for 3 minutes.
[0187] 3) Centrifuge at 12000g at 4°C for 15 minutes. At this time, it can be seen that the lysate is divided into three layers: the upper layer is RNA in the water phase; the middle layer is DNA, lipids, etc.; the lower layer is cell residues, proteins, polysaccharides, etc.
[0188] 4) Take 500ul of the supernatant into a new EP tube, pipette 167ul three times; add an equal volume of isopropanol, mix well, let stand for 10 minutes, then centrifuge at 12000g for 10 minutes at 4°C.
[0189] 5) Carefully remove the supernatant, be careful not to lose the RNA pellet, add 1...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com