Pig SOX10 mutant gene causing inner ear hypoplasia and application of pig SOX10 mutant gene
A technology of inner ear hypoplasia and SOX10, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of long breeding period, unfavorable scientific research, etc., and achieve the effect of high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Discovery and determination of mutation site of SOX10 c.321dupC
[0030] In the process of studying the mutation efficiency of homologous recombination caused by the Cas9 gene editing system, a series of mutant individuals were obtained, such as figure 1 shown. For details, please refer to the reference "Zhou, X., et al. (2016). Efficient Generation of Gene-Modified Pigs Harboring Precise Orthologous Human Mutation via CRISPR / Cas9-Induced Homology-Directed Repair in Zygotes. Hum Mutat 37(1): 110 -118)".
[0031]By analyzing and comparing the changes in the SOX10 protein coding sequence caused by the mutant sequences of the above-mentioned mutant individuals, the impact on the genome, and comparing the phenotype and genetic analysis of the point mutation SOX10 (c.325A>T) individuals among the obtained mutant individuals, it was found that c The .321dupC mutation can cause frameshift changes in SOX10 protein and prematurely terminate protein translation. At the same ti...
Embodiment 2
[0033] Preparation of SOX10 c.321dupC Single Base Duplication Mutation Genetic Engineering Miniature Pigs
[0034] Through the efficient genetic modification mediated by the CRISPR / Cas9 system, the SOX10 c.321dupC mutation site was targeted and introduced into the corresponding sequence of the normal pig SOX10 gene (SEQ ID NO: 1), and the positive pigs showed hypoplasia of the inner ear and showed dominant inheritance.
[0035] 1. sgRNA site selection (sgSOX10-exon2):
[0036] Sequence: 5'-agagcaaaccgcacgtcaag agg -3' (SEQ ID NO: 2), the sense strand located in the second exon of the porcine SOX10 gene, where the underlined bold part is the PAM structure.
[0037] 2. Design of single-stranded oligonucleotide DNA (pSOX10-321dupC-ssODN) as a homologous recombination template:
[0038] The sequence is as follows: 5'-tggaccctggtgcccatgcccgtgcgcgtcaacggcgccagcaagagcaaaccgcacgtc C aagaggcccatgaacgccttcatggtgtgggcgcaggcggcgcgcaggaagctggccgac-3' (SEQ ID NO: 3); the underlined bold...
Embodiment 3
[0080] SOX10 c.321dupC single-base duplication mutation genetic engineering miniature pig mutation detection
[0081] Exon 2 of SOX10 gene was amplified by PCR and sequenced. The results showed that all albino individuals had a single-base duplication mutation in exon 2 (c.321dupC, p.K108QfsX44), that is, a duplication of cytosine C at position 321 of the cDNA resulted in a frameshift mutation in the SOX10 protein and an early Terminate translation. The specific experimental method is as follows:
[0082] 1) Using Tiangen DNA Extraction Kit (#DP304, Tiangen), according to the method in the kit manual, extract DNA from the ear tissue of 5 F-generation individuals and measure its concentration, and store it at -20°C for later use;
[0083] 2) Using DNA as a template and using specific primers for porcine SOX10 gene (SEQ ID NO: 2-5), perform PCR according to the following reaction system and procedure to obtain an amplified product. Due to the high GC content of the SOX10 gene, ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com