A method for positioning and synthesizing terpenoids using Yarrowia lipolytica pathway
A technology of Yarrowia lipolytica and terpenoids, which is applied in the field of microbial technology and fermentation engineering, and can solve the problem of low theoretical yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Construction of an engineered Yarrowia lipolytica strain MP1 that localizes and expresses the mevalonate synthesis pathway in peroxisomes
[0040] 1.1 Construction of expression vector
[0041] (1) Add an enhanced peroxisome localization signal ePTS1 (the nine amino acid sequence of LGRGRRSKL at the carboxyl terminus of the protein) before the stop codon of the HMGR gene (AM902716.1) from Bordetella, and named the gene HMGR -ePTS1 (SEQ No. 1), synthesized by General Biosystems (Anhui) Co., Ltd. after codon optimization. And at the same time design primers according to the expression vector pKi-1 sequence:
[0042] HMGR-ePTS1-F:
[0043] ATAAGAATCATTCAAAGGTTATGTCTACCGACGCCAAAGAA
[0044] HMGR-ePTS1-R:
[0045] ACATAACTAATTACATGATTTTACAGCTTGGATCGTCGTC
[0046] Using the codon-optimized and synthesized HMGR-ePTS1 gene sequence as a template, the HMGR-ePTS1 assembly fragment carrying the corresponding terminal homologous sequence was amplified by PCR (polymer...
Embodiment 2
[0082] Example 2 Construction of Yarrowia lipolytica control engineering strain M1 expressing mevalonate pathway in cytoplasm
[0083] 2.1 Construction of expression vector
[0084] (1) Design primers according to the gene sequence of the optimized and synthesized HMGR-ePTS1 and according to the sequence of the expression vector pKi-1:
[0085] HMGR-F:
[0086] ATAAGAATCATTCAAAGGTTATGTCTACCGACGCCAAAGAA
[0087] HMGR-R:
[0088] ACATAACTAATTACATGATTTTAGCCCTGACCTCGGAGTCGAG
[0089] Using the codon-optimized and synthesized HMGR-ePTS1 gene sequence as a template, HMGR-F / HMGR-R primers were used for PCR (polymerase chain reaction) amplification to obtain HMGR assembled fragments carrying the corresponding terminal homologous sequences. PCR reaction conditions: pre-denaturation at 97 °C for 5 min, denaturation at 94 °C for 60 s, annealing at 56 °C for 30 s, extension at 72 °C for 3 min, followed by 30 cycles of extension at 72 °C for 10 min, and storage at 4 °C.
[0090] After...
Embodiment 3
[0113] Example 3 Comparison of the production efficiency of mevalonate by engineering strains MP1 and M1
[0114]Engineering strains: Yarrowia lipolytica engineering bacteria M1, MP1.
[0115] Yarrowia lipolytica M1 and MP1 stored in frozen glycerol tubes were streaked on YPG solid plates and cultured at 30°C for 30h.
[0116] The M1 and MP1 colonies grown on the YPG solid plate were respectively inserted into a 250mL conical flask containing 50ml of YPD liquid medium (peptone 20g / L, yeast powder 10g / L, glucose 20g / L), 30°C, 220rpm Rotational shaking culture activation.
[0117] Seed culture: Take 1ml of the activated culture solution and transfer it to a 250mL conical flask containing 50mL of seed medium (peptone 20g / L, yeast powder 10g / L, glucose 20g / L), 30 ℃, 220rpm aerobic culture for 24h .
[0118] Fermentation culture: Take 2mL of activated culture medium and transfer to 50mL of fermentation YPD medium (peptone 20g / L, yeast powder 10g / L, glucose 50g / L) and modified YJ...
PUM
Property | Measurement | Unit |
---|---|---|
pore size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com