Supercharge Your Innovation With Domain-Expert AI Agents!

A method for positioning and synthesizing terpenoids using Yarrowia lipolytica pathway

A technology of Yarrowia lipolytica and terpenoids, which is applied in the field of microbial technology and fermentation engineering, and can solve the problem of low theoretical yield

Active Publication Date: 2022-07-19
SHANDONG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the defect of low theoretical yield in the process of Yarrowia lipolytica producing mevalonate and downstream terpenoids through aerobic fermentation of glycolysis pathway, the present invention provides a method for targeted synthesis using Yarrowia lipolytica pathway The terpenoid approach

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for positioning and synthesizing terpenoids using Yarrowia lipolytica pathway
  • A method for positioning and synthesizing terpenoids using Yarrowia lipolytica pathway
  • A method for positioning and synthesizing terpenoids using Yarrowia lipolytica pathway

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Construction of an engineered Yarrowia lipolytica strain MP1 that localizes and expresses the mevalonate synthesis pathway in peroxisomes

[0040] 1.1 Construction of expression vector

[0041] (1) Add an enhanced peroxisome localization signal ePTS1 (the nine amino acid sequence of LGRGRRSKL at the carboxyl terminus of the protein) before the stop codon of the HMGR gene (AM902716.1) from Bordetella, and named the gene HMGR -ePTS1 (SEQ No. 1), synthesized by General Biosystems (Anhui) Co., Ltd. after codon optimization. And at the same time design primers according to the expression vector pKi-1 sequence:

[0042] HMGR-ePTS1-F:

[0043] ATAAGAATCATTCAAAGGTTATGTCTACCGACGCCAAAGAA

[0044] HMGR-ePTS1-R:

[0045] ACATAACTAATTACATGATTTTACAGCTTGGATCGTCGTC

[0046] Using the codon-optimized and synthesized HMGR-ePTS1 gene sequence as a template, the HMGR-ePTS1 assembly fragment carrying the corresponding terminal homologous sequence was amplified by PCR (polymer...

Embodiment 2

[0082] Example 2 Construction of Yarrowia lipolytica control engineering strain M1 expressing mevalonate pathway in cytoplasm

[0083] 2.1 Construction of expression vector

[0084] (1) Design primers according to the gene sequence of the optimized and synthesized HMGR-ePTS1 and according to the sequence of the expression vector pKi-1:

[0085] HMGR-F:

[0086] ATAAGAATCATTCAAAGGTTATGTCTACCGACGCCAAAGAA

[0087] HMGR-R:

[0088] ACATAACTAATTACATGATTTTAGCCCTGACCTCGGAGTCGAG

[0089] Using the codon-optimized and synthesized HMGR-ePTS1 gene sequence as a template, HMGR-F / HMGR-R primers were used for PCR (polymerase chain reaction) amplification to obtain HMGR assembled fragments carrying the corresponding terminal homologous sequences. PCR reaction conditions: pre-denaturation at 97 °C for 5 min, denaturation at 94 °C for 60 s, annealing at 56 °C for 30 s, extension at 72 °C for 3 min, followed by 30 cycles of extension at 72 °C for 10 min, and storage at 4 °C.

[0090] After...

Embodiment 3

[0113] Example 3 Comparison of the production efficiency of mevalonate by engineering strains MP1 and M1

[0114]Engineering strains: Yarrowia lipolytica engineering bacteria M1, MP1.

[0115] Yarrowia lipolytica M1 and MP1 stored in frozen glycerol tubes were streaked on YPG solid plates and cultured at 30°C for 30h.

[0116] The M1 and MP1 colonies grown on the YPG solid plate were respectively inserted into a 250mL conical flask containing 50ml of YPD liquid medium (peptone 20g / L, yeast powder 10g / L, glucose 20g / L), 30°C, 220rpm Rotational shaking culture activation.

[0117] Seed culture: Take 1ml of the activated culture solution and transfer it to a 250mL conical flask containing 50mL of seed medium (peptone 20g / L, yeast powder 10g / L, glucose 20g / L), 30 ℃, 220rpm aerobic culture for 24h .

[0118] Fermentation culture: Take 2mL of activated culture medium and transfer to 50mL of fermentation YPD medium (peptone 20g / L, yeast powder 10g / L, glucose 50g / L) and modified YJ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pore sizeaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for locating and synthesizing terpenoids by utilizing the Yarrowia lipolytica pathway, which comprises combining acetyl-CoA thiolase, HMG-CoA synthase and HMG-CoA reductase was overexpressed and localized to peroxisomes to obtain engineering strain MP1; on the basis of engineering strain MP1, express α-farnesene synthesis pathway to obtain engineering strain FP1; or express β-carotene synthesis or express the linalool synthesis pathway to obtain the engineered bacteria LP1; so that the strains FP1, CP1 or LP1 can use the medium containing fatty acids or oils to synthesize terpenoids under aerobic conditions, which is more efficient than using traditional The yield of terpenoids synthesized by the method is higher. The method of the invention can utilize fatty acid, grease and cheap kitchen waste oil to produce the terpenoid downstream of mevalonate, and has considerable application prospect and economic value.

Description

technical field [0001] The invention relates to a method for locating and synthesizing terpenoids by utilizing Yarrowia lipolytica pathway, and belongs to the fields of microorganism technology and fermentation engineering. Background technique [0002] Terpenoids are compounds and their derivatives which are derived from mevaleric acid and whose molecular backbone is an isoprene unit as the basic structural unit. Terpenoids are a relatively important class of compounds in Chinese herbal medicine. Many compounds have been found to be active ingredients in Chinese herbal medicine. They are also an important class of natural fragrances and are indispensable raw materials for cosmetics and food industries. Some compounds are still important. Industrial raw materials. The mevalonate pathway is a very important pathway that is widely present in eukaryotic cells, archaea, Gram-positive bacteria and higher plant cells. Isopentenyl diphosphate (IPP) can be generated through the me...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12P7/42C12P5/02C12P23/00C12P7/02C12N15/81C12R1/645
CPCC12P7/42C12P5/026C12P23/00C12P7/02C12N15/815
Inventor 祁庆生侯进蒋新崔志勇郑会会
Owner SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More