Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of ginger floral benzene cyclic ester floral fragrance gene hcbsmt and its application

A benzene ring type and genetic technology, applied in the field of genetic engineering, to achieve the effect of shortening the breeding time

Active Publication Date: 2020-02-21
SOUTH CHINA AGRI UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, foreign researchers are only in Arabidopsis (Chen et al. , 2003), petunias (Negre et al. , 2003) and ornamental tobacco (Hippauf et al. , 2010), the enzyme was identified in several dicotyledonous plants, but less reported in monocotyledonous plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of ginger floral benzene cyclic ester floral fragrance gene hcbsmt and its application
  • A kind of ginger floral benzene cyclic ester floral fragrance gene hcbsmt and its application
  • A kind of ginger floral benzene cyclic ester floral fragrance gene hcbsmt and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 HCBSMT Acquisition of gene cDNA and full-length DNA

[0032] S1. Extraction of RNA from ginger flower petals: Trizol method was used to extract RNA from ginger flower petals. Weigh 0.1 g of the petal material and quickly grind it into powder in liquid nitrogen, transfer it to a centrifuge tube containing 1.0 ml Trizol, shake vigorously to mix, and let it stand at room temperature for 5 min. Centrifuge at 12,000 g for 5 min at 4°C. Carefully aspirate the supernatant, transfer it to a new centrifuge tube, add 200 μl of chloroform, cover the centrifuge tube tightly, mix until the solution emulsifies and turns milky white, and let stand at room temperature for 5 min. Centrifuge at 12,000 g for 15 min at 4°C. Aspirate the supernatant and transfer it to another new centrifuge tube, add an equal volume of isopropanol, invert the centrifuge tube up and down to mix thoroughly, and let stand at room temperature for 10 min. Centrifuge at 12,000 g for 10 min at 4°C. ...

Embodiment 2

[0036] Example 2 The determination and HCBSMT Gene expression analysis of

[0037] S1. Determination of floral aroma substances of benzene cyclic esters of ginger flower: seal the sample to be tested in the gas measuring device, add 1.728 μg ethyl caprate as internal standard at the same time, collect flower aroma substances and internal standard substances for 30 min, insert 50 / 30 μmDVB / CAR / PDMS extraction head (Supelco) for 30 min, then GC-MS detection and weighing of samples. The conditions of gas chromatography (Agilent 7890A GC system) are: HP-5MS column (30 m×0.25 μm); high-purity helium carrier gas, inlet temperature of 250°C, splitless injection, and column flow rate of 1 ml / min, the analysis time is 3 min. Temperature program: the initial column temperature was 40°C, kept for 2 minutes, then raised to 250°C at a rate of 10°C / min, and kept for 5 minutes. Mass spectrometry (Agilent 5975CMSD) conditions are: interface temperature 220°C, electron bombardment source EI...

Embodiment 3

[0040] Example 3 In vitro functional analysis of HcBSMT

[0041] S1. Carrier Construction: According to HCBSMT The cDNA sequence of the gene, designed to contain Eco RI and not Specific primers for restriction site I, upstream primer F: GAATTC ATGGGTTTGAAGGTGGAGCA, as shown in SEQ ID NO: 13; downstream primer R: GCGGCCGC ATACTCTTTTCTTCAAGGCAA TGAC, as shown in SEQ ID NO:14. The high-fidelity enzyme KOD-plus was used for PCR amplification. After the amplified product was recovered, it was digested with the pET-30a vector at 37°C for 3 h at the same time. After the digestion, the DNA fragment was purified. The purified target fragment and vector were ligated overnight at 16°C with T4 DNA ligase, and the ligated product was transformed into E. coli After the DH5α competence was confirmed by sequencing, the recombinant plasmid was transferred into the Rosetta2 (DE3) pLysS strain.

[0042] S2. Recombinant protein expression and purification: Pick a single colony and ino...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a ginger flower benzene-ring ester fragrance gene HcBSMT and an application thereof. A full-length cDNA (complementary deoxyribonucleic acid) sequence of the HcBSMT gene is asshown in SEQ ID NO: 1, a full-length DNA sequence of the HcBSMT gene is as shown in SEQ ID NO: 2, a coding sequence of the HcBSMT gene is as shown in SEQ ID NO: 3, a corded amino acid sequence of theHcBSMT gene is as shown in SEQ ID NO: 4, the HcBSMT gene is expressed in ginger flower tissues with fragrance and is not expressed in ginger flower tissues without fragrance, expression of the HcBSMTgene is and adjusted and controlled by flower development, and a expression pattern is associated with fragrance release. The HcBSMT gene is led into ginger flower or other plant cells, floral transgenic plants expressing the gene can be acquired, specific molecular markers can be generated according to gene sequence information and are used for identifying ginger flower genus and fragrance gene types of filial generations and used for marker-assisted selection, so that breeding selection efficiency is improved, and the fragrance gene has a wide application prospect.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, more specifically, relates to a ginger flower benzene cyclic ester floral fragrance gene HCBSMT and its application. Background technique [0002] Floral fragrance is one of the important aesthetic and commercial traits of ornamental plants, which has been paid more and more attention in recent years. Studies have shown that consumers prefer floral varieties with aromatic scents over non-scented varieties (Pichersky et al. , 2007). According to modern medical research, the floral fragrance of many plants can make people happy physically and mentally, calm the mind, relieve fatigue, boost the spirit, and play a certain role in health care and disease treatment (Yang Xuhang et al., 2001). In addition, fragrant flowers and herbs can also be used to extract plant essential oils, which are widely used in cosmetics and pharmaceutical industries, and have great commercial value. [000...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12Q1/68C12N15/11C12N15/82A01H5/00C11B9/00A01H6/00
CPCC11B9/00C12N9/1007C12N15/8261C12Q1/6895C12Q2600/13
Inventor 范燕萍岳跃冲余让才何杰玲李昕悦玉云祎
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com