Recombinant expression protein of 1301 ORF136 genes of herpesvirus cyprinid type 3, antibody and application of antibody
A carp herpes virus, gene recombination technology, applied in the direction of antiviral immunoglobulin, virus/bacteriophage, application, etc., can solve the problem that serological diagnosis has not been widely used, and achieve high recovery rate, high purity, good biological active effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Step 1. Amplification of KHV 1301 strain ORF136 gene
[0040] According to the CyHV-3ORF136 gene sequence in GenBank, the bioinformatics software ABCpred (http: / / www.imtech.res.in / raghava / abcpred / ), BepiPred 1.0 (http: / / www.cbs.dtu.dk / services / BepiPred / ) and DNAstar submodule Protean predict the potential B cell epitope of ORF136 gene.
[0041] Design specific primers with Primer Premier 5.0 (specific primers are:
[0042] F: CCG GAATTC GGCACAACAACCATGAACTCTACC (SEQ ID NO: 3) (contains EcoR I restriction site, see the underlined part),
[0043] R: CCG CTCGAG TTAGATTTTTCTAAAGTGCACGACGTC (SEQ ID NO: 4) (containing the Xho I restriction site, see the underlined part),
[0044] And synthesized by Sangon Biotech.
[0045] The virus genome was extracted according to the instructions in the blood / cell / tissue DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., Beijing).
[0046] PCR reaction system: 12.5ul rTaq Mix, 1ul each primer (10umol / L) and 1ul DNA templ...
Embodiment 2
[0063] SDS-PAGE and western blot analysis (Western blot)
[0064] Polyacrylamide gel is composed of 12% separating gel and 4% stacking gel. The purified CyHV-3 1301 strain virus, RIPA lysate lysed KS cells infected with CyHV-3 and KS cells not infected with CyHV-3 Mix with 5× protein loading buffer in proportion, heat in boiling water for 5 minutes, and spot samples for electrophoresis analysis (200V, 35 minutes) after cooling. Transfer the gel separated by SDS-PAGE to a nitrocellulose membrane by wet transfer method, block with 5% skimmed milk powder at room temperature for 1 hour, and then use the polyclonal antibody obtained in step 4 of Example 1 diluted with blocking agent 1:1000 at room temperature Incubate at room temperature for 1 h, then wash with 0.05% PBST for 3 times, each time for 10 min; finally, incubate with HRP-labeled goat anti-rabbit IgG diluted at 1:10000 in blocking agent for 1 h at room temperature, wash with 0.05% PBST for 3 times, and develop DAB color ...
Embodiment 3
[0067] Detection of infected cells by indirect immunofluorescence assay
[0068] The koi snout cells (KS cells) were passaged into 96-well cell culture plates, and after the cells grew to about 80% of the monolayer confluence, they were infected with CyHV-3 1301 strain virus; after 5 days of virus infection, the cells in the culture plates were Aspirate the culture medium, wash with 0.01mol / L PBS three times, add 80% acetone solution and incubate at room temperature for 30min, absorb the acetone, and dry at room temperature for 1h; add 100μl 1:1000 diluted rabbit anti-ORF136 protein polyclonal antibody to each well , incubate at 37°C for 1 hour, wash with PBST three times, add 100 μl of goat anti-rabbit IgG-FITC-labeled fluorescent secondary antibody diluted 1:50, incubate at 37°C for 1 hour; wash with PBST for three times, and finally add the nuclear dye propidium iodide (PI ) for 5 minutes, and observe the results under a fluorescent inverted microscope (Nikon, Eclipse Ti-S)...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com