Method for efficiently producing recombinant avian adeno-associated virus
A technology for recombining baculovirus and poultry gland, applied in biochemical equipment and methods, viruses, virus/bacteriophage, etc., to achieve the effect of easy to expand production, easy to expand use, and broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Construction of the double-expression recombinant plasmid pFB-Rep containing AAAV functional protein gene Rep78 and Rep52 and preparation of recombinant baculovirus rBacRep
[0028] According to the gene sequence of AAAV-YZ strain (GeneBank accession number: GQ368252), two pairs of primers Rep78-F / R and Rep52-F / R were designed,
[0029] Rep78-F: 5'-CTAGCTAGCATGAGGTCGTACTACGAGGTC-'3 (SEQ ID No.1)
[0030] Rep78-R: 5'-CTAGCTAGCTCAGCCGCAGCGTTGACTCCC-'3 (SEQ ID No.2)
[0031]Rep52-F: 5′-CTAGTCGACATGGAGCTCGTGGATTGGCTC-′3 (SEQ ID No.3)
[0032] Rep52-R 5'-CTAGCGGCCGCTCAGCCGCAGCGTTGACTCCC-'3 (SEQ ID No.4)
[0033] The AAAV functional genes Rep78 and Rep52 were respectively amplified using pCR-AAAV (including the whole genome sequence of AAAV) as a template. The amplified Rep78 product was digested with Nhe I and inserted into the baculovirus transfer vector pFastBacDual to obtain the recombinant plasmid pFBDRep78. The amplified product of Rep52 was digested with S...
Embodiment 2
[0035] Example 2 Construction of recombinant plasmid pFB-VP containing 3 kinds of structural protein genes VP1, VP2 and VP3 of AAAV and preparation of recombinant baculovirus rBacVP
[0036] Design a pair of primers according to the gene sequence of AAAV-YZ strain (GeneBank accession number: GQ368252)
[0037] VP-F: 5′-CATGCGGCCGCCACGGCTCTTATTTCTGACGCGATACCCGATTGGTTG-′3 (italics indicate gene mutation site) (SEQ ID No.5)
[0038] VP-R: 5'-CGTAAGCTTTTACAGCGGTTTGGTGAGGTAACGGGTACCG-'3 (SEQ ID No.6), the open reading frame of AAAV structural gene VP was amplified using pCR-AAAV (containing the whole genome sequence of AAAV) as a template. The obtained PCR product was digested with NotI and HindIII enzymes and inserted into the baculovirus transfer vector pFastBac1, and the obtained recombinant plasmid was named pFB-VP. DH10Bac was transformed, and the recombinant bacmid rBacmid-VP was obtained through resistance and blue-white screening and PCR identification. The bacmid was pur...
Embodiment 3
[0040] Example 3 Construction of the green fluorescent protein reporter gene transfer vector pFB-ITRGFP regulated by the giant cell CMV promoter and preparation of recombinant baculovirus rBacGFP
[0041] In order to remove the EcoRI site at the multiple cloning site of pEGFP-N1, the recombinant plasmid obtained was used as a template after digestion with HindIII and SacII to fill in the blunt connection, and GGAGTCGACTAGTTATTAATAGTAATC (SEQ ID No. 7) / GCAACGCGTCTTAAGATACATTGATG (SEQ ID No. 8) Amplify the GFP expression frame with primers, insert pCR-AAAV into the vector fragment after PmlⅠ and BsmBI enzyme digestion and make up, obtain the recombinant plasmid pCRITRGFP, and use EcoRI enzyme digestion pCRITRGFP to recover the fragment containing ITR and GFP expression cassette on both sides , into the baculovirus transfer vector pFastBac1 to obtain the recombinant plasmid pFB-ITRGFP. DH10Bac was transformed, and the recombinant bacmid rBacmid-GFP was obtained through resistance...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com