Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Method and kit used for determining human TERF1 gene rs201882345 site polymorphism

A site polymorphism, gene technology, applied in the field of determination of single nucleotide polymorphism, can solve problems such as high price, and achieve the effects of reduced measurement cost, good yield and specificity

Inactive Publication Date: 2016-01-20
ZHENGZHOU UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The rs201882345 polymorphic site of the TERF1 gene is detected by PCR-RFLP technology, and the required endonuclease is ApoI endonuclease, which is expensive and requires the development of new detection technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit used for determining human TERF1 gene rs201882345 site polymorphism
  • Method and kit used for determining human TERF1 gene rs201882345 site polymorphism
  • Method and kit used for determining human TERF1 gene rs201882345 site polymorphism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Determination of rs201882345 polymorphism by extracting DNA from human peripheral blood leukocytes

[0060] 1 Materials and methods

[0061] 1.1 Main reagents and instruments

[0062] Reagent: 2×PCRMix (including 4 kinds of dNTP mixture, Mg 2+ , TaqDNApolymerase, TaqAntibody, buffer, DMSO and ammonium sulfate), restriction endonuclease HinfI (NEB Company), agarose (Biowest Company), and primers were synthesized by Shanghai Sangon Company.

[0063] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (PharmaciaBiotech, EPS1000), GelDoc2000 gel imager (Bio-RAD Company).

[0064] 1.2 Extract DNA from peripheral blood leukocytes as the template of genomic DNA to be tested

[0065] EDTA-K 2 Collect 1mL of human peripheral blood with an anticoagulant tube, and separate leukocytes by referring to the leukocyte separation method in "Practical Flow Cytometry Color Atlas", and extract leukocyte genomic DNA by referring to the sodium chlorid...

Embodiment 2

[0091] Example 2 Determination of TERF1 gene rs201882345 polymorphism in whole blood samples of human peripheral blood:

[0092] The main reagents and instruments are the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract peripheral blood genomic DNA and use it as a human genomic DNA template to be tested.

[0093] The sequence search was the same as in Example 1, and the primer sequences were designed as follows:

[0094] Upstream primer: 5'CTTTAAAGAAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCA G AT3' (SEQ ID NO: 7);

[0095] Downstream primer: 5'TCTGTTGCACGGTATTATTCTATACTGTTTAA3' (SEQ ID NO: 8).

[0096] Take genomic DNA (50-80ng), upstream and downstream primers (final concentration 0.1-1μM), 2×PCRMix 10μL (including 4 kinds of dNTP mixture, Mg 2+ , TaqDNApolymerase, TaqAntibody, buffer, DMSO and ammonium sulfate), sterilized double distilled water to make up 20 μL of the reaction system, and adjust the pH of the ...

Embodiment 3

[0112] Example 3 Determination of TERF1 gene rs201882345 polymorphism in human peripheral blood clot specimen:

[0113] The main reagents and instruments are the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract genomic DNA from blood clots.

[0114] The upstream primer used in the PCR reaction is SEQNO:12, and the downstream primer is SEQNO:13.

[0115] Upstream primer: 5'AAAATGGCAACTTTAAAGAAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCA G A3' (SEQ ID NO: 12);

[0116] Downstream primer: 5'GCACGGTATTATTCTATACTGTTT3' (SEQ ID NO: 13)

[0117] Except that the annealing temperature of PCR amplification is 65° C., the other reaction conditions are the same as in Example 1; the enzyme digestion reaction conditions are the same as in Example 1. After 1-fold concentration, the digested product was subjected to electrophoresis on 2.5% agarose gel at 5V / cm for 35min, and photographed under ultraviolet light for identification....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and a kit used for determining human TERF1 gene rs201882345 site polymorphism. The method comprises following steps: human genome DNA to be determined is provided; upstream primers and downstream primers used for amplification of sequences near human TERF1 gene rs201882345 site are provided, wherein the upstream primers possess mismatched base G; the human genome DNA to be determined is taken as a template, and the upstream primers and the downstream primers are used for PCR amplification so as to obtain amplification products containing GATTM segments, wherein M is used for representing base A or C to be determined on human TERF1 gene rs201882345 site; a restriction enzyme is provided; the restriction enzyme is used for enzyme digestion of the amplification products so as to obtain corresponding enzyme-digested products; and it is determined that M is used for representing base A or C based on the enzyme-digested products. The restriction enzyme is a restriction enzyme only used for realizing restriction digestion of one segment of GATTA or GATTC. The method is rapid and reliable, and determination cost is reduced greatly.

Description

technical field [0001] The present invention relates to methods for determining single nucleotide polymorphisms. Background technique [0002] SNP (Single Nucleotide Polymorphism) refers to the DNA sequence variation caused by the change of a single nucleotide, including single base substitution, insertion and deletion. Gene polymorphism is an individual's innate genetic characteristics, does not change with the environment, and is not a specific or non-specific clinical manifestation of a certain disease, so its application does not have diagnostic and therapeutic functions. [0003] Gene polymorphism detection is widely used in the field of genetics and medicine, examples are as follows: 1. To study genetic phenomena such as the origin and evolution of species. According to the genetic variation, the information of biological macromolecules can be obtained, the history of biological evolution can be inferred, and the evolution relationship of species can be clarified. It...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q2521/301C12Q2525/117
Inventor 路红显高庆国张成鹏曹小雨段晓冉冯晓蕾姚武杨永利施学忠王威
Owner ZHENGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com