Huperzia serrata endophytic fungus and application in preparation of pyrrole type liver-protecting medicines

A technology of Huperzia serrata and endophytic fungi is applied in the field of microorganisms, which can solve the problems that the output cannot be guaranteed for industrialized scale production, many preparation steps, long plant growth cycle, etc., and achieves alleviation of clinical drug shortage, simple fermentation conditions, and fewer process steps. Effect

Active Publication Date: 2014-03-26
郎溪品旭科技发展有限公司
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] As mentioned above, most of the preparation methods of existing FPBA compounds are extraction and separation from medicinal plants. The disadvantages of this technical solution are: ① The reaction conditions for extraction and separation are complicated, and there are many preparation steps; The content is low, and the cost of preparing such compounds from plant sources is high
③ The plant growth cycle is long, and it is greatly affected by environmental uncertainties such as climate and weather, so the output cannot guarantee the demand for industrial scale production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Huperzia serrata endophytic fungus and application in preparation of pyrrole type liver-protecting medicines
  • Huperzia serrata endophytic fungus and application in preparation of pyrrole type liver-protecting medicines
  • Huperzia serrata endophytic fungus and application in preparation of pyrrole type liver-protecting medicines

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Separation of endophytic fungus (Peyronellaea glomerata) HS-ZJUT-XW12

[0030] (1) Collection of samples

[0031] The samples were Huperzia serrata plants collected from Yunnan Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences in September 2007.

[0032] (2) Isolation of strains

[0033] Wash the epidermis and roots of the plant with tap water, immerse the cleaned plant sample in a container containing 75% ethanol, take it out after 2 minutes, rinse it with sterile water for 3-5 times, and then immerse it in a container containing 0.1% mercuric chloride In the container of aqueous solution, keep it for a certain period of time for 1 minute, take it out, and rinse with a large amount of sterile water to remove residual mercury chloride solution. Under sterile operating conditions, use sterilized forceps and blades to peel off the outer skin of the stems of Huperus serrata stems, then cut into 0.3cm×0.3cm tissue pieces and plant them on PDA ...

Embodiment 2

[0036] Example 2 Molecular biological identification of Huperzia serrata endophyte (Peyronellaea glomerata) HS-ZJUT-XW12

[0037] (1) Extraction of DNA

[0038] Take the fermented liquid cultured for 6 days, collect the mycelia by centrifugation, freeze and grind the mycelium with liquid nitrogen, and extract the genomic DNA with the SK1375 genomic DNA extraction kit (manufacturer: Sangon Bioengineering (Shanghai) Co., Ltd.) Sugar gel electrophoresis.

[0039] (2) PCR amplification of ITS region sequence

[0040] The primer sequences are: ITS1: 5'TCCGTAGGTGAACCTGCGG3'; ITS4: 5'TCCTCCGCTTATTGATATGC3'.

[0041] The PCR system (50μL) is composed of: Template (genome) 10pmo1, Primer1 (10μM) 1μL, Primer2 (10μM) 1μL, dNTP mix (10Mm each) 1μL, 10×Taq reaction buffer 5μL, Taq (5U / μL) 0.25μL, add water to 50 μL.

[0042] The PCR program was set as follows: pre-denaturation at 98°C for 5 min, denaturation at 95°C for 35 s, annealing at 55°C for 35 s, extension at 72°C for 40 s, 35 c...

Embodiment 3

[0047] Example 3 Preparation of FPBA by fermentation of the endophytic fungus Peyronellaea glomerata HS-ZJUT-XW12

[0048] (1) Strain activation

[0049] Potato glucose agar medium: 200g of peeled potatoes, 20g of glucose, 15g of agar, 1000mL of water, make a test tube slope, pick mycelium and inoculate it on the test tube slope, culture at 28°C for 7 days;

[0050] (2) Strain fermentation

[0051] Potato glucose liquid medium: 200g peeled potatoes (cut into about 2cm 2 small pieces), put into a beaker and boil for 30min, then filter with double-layer gauze, take the filtrate and add 20g of glucose, add water to make up to 1000mL.

[0052] The endophytic fungus (Peyronellaea glomerata) HS-ZJUT-XW12 strain suspension prepared in step (1) (spore concentration is 1 × 10 6 Each / mL) 1mL was inoculated in a 250mL Erlenmeyer flask (125mL potato dextrose liquid medium was sterilized at 121°C in the bottle), shaken at 28°C and 180 rpm for 6 days, and then cultured statically for 14 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a huperzia serrata endophytic fungus which is obtained by separation from a stem part of a living body of a pteridophyte huperzia serrata plant and classified and named as peyronellaea glomerata HS-ZJUT-XW12, wherein the strain is collected in China Center for Type Culture Collection (CCTCC) on the collection date of October 28, 2012 with the collection number of CCTCC NO: M 2012434. The strain provided by the invention is found by inventors after years of creative experimental labor, and the strain is firstly used for fermentation and culture so as to prepare a compound FPBA with liver-protecting activity; the preparation method has the advantages of simple fermentation conditions, easiness in culture of the strain, few process steps, short production period and the like, and further has potential for realizing industrial large-scale production; a new way is provided for seeking sources for developing pyrrole type liver-protecting medicines, and the shortage of clinical medicines can be alleviated to a certain extent.

Description

technical field [0001] The invention relates to the technical field of microorganisms, in particular to an endophytic fungus of Huperzia serrata and its application in the preparation of pyrrole-type liver-protecting medicines, that is, to the application of a microbial fermentation method to prepare pyrrole-type liver-protecting medicines. Background technique [0002] At present, viral hepatitis, alcohol and drug poisoning liver disease, various liver injuries and subsequent diseases such as liver fibrosis, liver cirrhosis, and liver failure have seriously endangered human health, and the degree of harm is escalating. Appropriate and effective selection of liver-protecting drugs can not only rapidly improve the patient's clinical symptoms and prognosis, but also lay the foundation for further etiological treatment. Although many new-generation liver-protecting drugs and their treatments have been developed successively at home and abroad in recent years, there is still a l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/14C12P17/10C12R1/645
Inventor 单伟光应优敏占扎君
Owner 郎溪品旭科技发展有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap