Supercharge Your Innovation With Domain-Expert AI Agents!

A broad-spectrum neutralizing molecule 1f2 against influenza virus

A technology of influenza virus and human monoclonal antibody, applied in the direction of antiviral agents, antiviral immunoglobulins, antibodies, etc., can solve the problems of restricting the large-scale use of chemical small molecule drugs and not recommending alkylamine drugs, etc., to achieve prevention Or the effect of treating multiple influenza virus infections

Active Publication Date: 2016-07-06
CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

A large number of drug-resistant influenza strains have emerged for alkylamine drugs, so the World Health Organization does not recommend the use of alkylamine drugs as a drug for treating influenza; most influenza viruses (including influenza A H1N1) are still resistant to Seltamivir and zanamivir are sensitive, but drug-resistant strains have also appeared in Japan and other regions, and the emergence of drug-resistant strains limits the large-scale use of these chemical small molecule drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A broad-spectrum neutralizing molecule 1f2 against influenza virus
  • A broad-spectrum neutralizing molecule 1f2 against influenza virus
  • A broad-spectrum neutralizing molecule 1f2 against influenza virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0179] Example 1, HA-specific memory B cells

[0180] Using FITC-CD19 / APC-IgG / Cy3-HA as specific markers, several HA-specific B cells were obtained.

Embodiment 2

[0181] Embodiment 2, antibody gene

[0182] RT-PCR and Nested-PCR method to obtain antibody heavy and light chain variable region genes, the molecular weight is about 400bp, β-actin is used as an internal reference (343bp), and the electrophoretic pattern is shown in figure 2 , image 3 and Figure 4 . The variable regions of heavy and light chain genes derived from the same B cell antibody were connected to T vectors, sequenced and constructed for expression vectors.

[0183] The 1F2 heavy chain variable region gene sequence is as follows (SEQ ID NO: 1):

[0184] GAGGTGCAGCTGGTGCAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCTCTGGATTCACCTTTAGC TGGGTCCGCCAGGCTCGAGGGAAGGGGCTGGAGTGGGTCTCA CGCTTCACCATCTCCAGAGACAATTCCAAGAACACGGTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCCTATATTACTGTGCGAAA TGGTTCGACCCCTGGGGCCAGGGAACCCGGGTCACCGTCTCCTC

[0185] Remarks: the sequences marked with double underlines are heavy chain gene CDR1 (SEQ ID NO: 5), CDR2 (SEQ ID NO: 6), and C...

Embodiment 3

[0195] Embodiment 3, antibody expression

[0196] The results of ELISA showed that the fully human antibody was successfully expressed. Because the expression vector already contained the constant region of the heavy and light chain, the 293T cells transfected with the empty vector could also express the constant region of the heavy and light chain of the antibody. See Figure 5 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an anti-influenza-virus broad-spectrum-neutrality neutralizing molecule 1F2 capable of neutralizing multiple influenza virus subtypes. The functions of the antibody provided by the invention are determined by specific gene sequences of genes in light chain and heavy chain variable regions; and the antibody can be combined with HA2 subunit of influenza virus hemagglutinin (HA) with native conformation, and can prevent multiple influenza virus subtypes from infecting permissive cells. By utilizing the variable region genes or complementary determining region (CDR) genes, different forms of gene engineering antibodies can be modified and produced in any expression system using prokaryotic and eukaryotic cells.

Description

technical field [0001] The invention provides a fully human monoclonal antibody 1F2 capable of neutralizing various subtypes of influenza viruses, which has the potential to prevent or treat various influenza virus infections clinically. Background technique [0002] Since April 2009, influenza A (H1N1) (A / H1N) outbreaks have broken out worldwide. The epidemic spread rapidly from North America to more than 200 countries and regions on five continents. According to the World Health Organization, as of April 9, 2010, influenza A / H1N1 has broken out in more than 213 countries, and the number of deaths from influenza A / H1N1 worldwide has exceeded 17,700. In my country, according to the Chinese Center for Disease Control and Prevention, as of March 31, 2010, more than 127,000 confirmed cases of Influenza A (H1N1) had been reported in 31 provinces across the country, 122,000 had been cured and 800 had died. [0003] Influenza viruses belong to the Orthomyxoviridae family and hav...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/10C12N15/13G01N33/569G01N33/577A61K39/42A61P31/16C12N15/63C12N1/21C12N1/19C12N5/10
Inventor 孙兵陈爱中边超胡伟斌王同燕凌志洋
Owner CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More