Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

HIV type I protease inhibitor screened out from crude extract of Berberis nummularia Bge, and application thereof

A technology of AIDS virus and protease, which is applied in the direction of antiviral agents, microbe determination/inspection, medical preparations containing active ingredients, etc.

Inactive Publication Date: 2013-07-03
TIANJIN INT JOINT ACADEMY OF BIOTECH & MEDICINE
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This is also currently unattainable based on the determination of enzyme activity at the molecular level.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HIV type I protease inhibitor screened out from crude extract of Berberis nummularia Bge, and application thereof
  • HIV type I protease inhibitor screened out from crude extract of Berberis nummularia Bge, and application thereof
  • HIV type I protease inhibitor screened out from crude extract of Berberis nummularia Bge, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1: Expression, purification and crystal growth of HIV protease

[0059]The HIV-1 cDNA library (pNL4-3) was donated to the laboratory of Professor Gao Guangxia, Institute of Biophysics, Chinese Academy of Sciences. The gene fragment of HIV-1 Protease was obtained by polymerase chain reaction, and it was constructed on the pET-11a vector.

[0060] PCR upstream and downstream primers are:

[0061] 5'protease-11a-s ATCATATGGCCGATAGACAAGGAAC

[0062] 5'protease-11a-as GCGGATCCCTAAAAATTTAAAGTGC

[0063] Gene sequence of HIV-1protease:

[0064] GCCGATAGACAAGGAACTGTATCCTTTAGCTTCCCTCAGATCACTCTTTGGCAGCGACCCCTCGTCACAATAA

[0065] AGATAGGGGGGCAATTAAAGGAAGCTCTATTAGATACAGGAGCAGA

[0066] TGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAA

[0067] AAATGATAGGGGGAATTGGAGGTTTTATTCAAAGTAAGACAGTATGAT

[0068] CAGATACTCATAGAAATCTGCGGACATAAAGCTATAGGTACAGTATT

[0069] AGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTC

[0070] AGATTGGTTGCACTTTAAATTTTTAG

[0071] Amino acid sequence...

Embodiment 2

[0088] Embodiment 2: the preparation of the alternative sample of barberry

[0089] Remove dead branches, dead leaves and other impurities from the whole Berberis chinensis herb, wash it, cut it into pieces, and dry it in a vacuum oven at 50°C for 12 hours. Accurately weigh 500 grams of dried and pulverized Berberis fructus, add 1000 mL of 95% ethanol to a 2500 mL round bottom flask, extract in a water bath at 80 °C for 4 hours, and filter while hot. Then, 1000 mL of 95% ethanol was added to the residue for a second extraction for 3 hours, and suction filtration was also performed while it was hot, and the filtrates were combined. Then, the combined filtrate was concentrated to about 20 mL, transferred to petri dishes for natural evaporation and drying at room temperature, and then transferred to a vacuum oven at 50° C. for drying for 24 hours to obtain extracts.

[0090] Weigh 20.5 grams of this extract, suspend it with 150 milliliters of double-distilled water, pour it into...

Embodiment 3

[0093] Example 3: Determination of HIV Protease Inhibitory Activity of Alternative Samples of Red Berberis

[0094] For the in vitro activity assay method of HIV-1 protease, refer to (Dieter Hoffmann et al., Journal of Clinical Virology 32 (2005) 294299), with appropriate improvements.

[0095] AIDS protease activity was assayed using the fluorescent substrate MCA-γ

[0096] -Abu-Ser-Gln-Asn-Tyr-Pro-Ile-Val-Gln--Lys(Dnp)-Lys-NH2 (purity greater than 95%, Shanghai Gil Biochemical Co., Ltd.) to complete. The amino acid sequence of the fluorescent substrate is derived from the specific cleavage sequence of HIV protease. The instrument used for the determination of fluorescence intensity was a Fluoraskan Ascent fluorimeter (ThermoLabsystems, Helsinki, Finland), and the wavelengths of excitation light and emission light were 320 nm and 405 nm, respectively.

[0097] The samples in the candidate library of natural product mixtures such as traditional Chinese medicines prepared acc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for screening an HIV protease inhibitor based on combination of a fluorogenic substrate and crystal soak. The method comprises the steps of measuring inhibitory activity of a series of compounds that are separated and purified from natural products to the HIV-1 protease; and finally separating and purifying the series of compounds into a single component, wherein the single component is a small molecular inhibitor of the natural products. With the above method, the extract of the Berberis nummularia Bge is found to have effective inhibitory activity for the HIV-1 protease; small molecules with relatively strong combination capacity for the HIV-1 protease are found via the crystal soak method; then the inhibitory activity of the small molecules to the HIV-1 protease is determined via enzyme activity assay; and finally a small molecular inhibitor capable of effectively inhibiting the activity of the HIV-1 protease is provided. Besides, a method for screening anti-HIV materials by the combination of the small molecular substance and an HIV protease compound is provided, novel sites that the HIV protease can interact to the inhibitor are provided, and a method for screening the anti-HIV active materials by using the sites is provided.

Description

technical field [0001] The present invention relates to a screening method for anti-HIV substances and its application. Specifically, HIV protease inhibitors are jointly screened by fluorescent substrates and crystal immersion, and a series of compound components separated and purified by biological activity tracking tests are used in natural products. Inhibitory activity on HIV-1 protease, until the final isolation and purification of small molecule inhibitors of natural products with a single component. Background technique [0002] AIDS, the medical full name is "Acquired Immune Deficiency Syndrome" (Acquired Immune Deficiency Syndrome--AIDS), and now scientific research generally believes that it is an infectious disease caused by human immunodeficiency virus (Human immunodeficiency virus, referred to as HIV) . HIV belongs to the Retroviridae family, the lentivirus genus, and the primate immunodeficiency subgenus. It has been confirmed that HIV is divided into two type...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/37C12N9/50A61K36/29A61K31/4375A61P31/18G01N21/64
Inventor 饶子和杨诚郭宇唐延婷牛国君孙玉桃汪颖李智
Owner TIANJIN INT JOINT ACADEMY OF BIOTECH & MEDICINE
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More