Colon bacillus outer membrane protein monoclonal antibody and preparation method and application thereof
A technology of monoclonal antibody and Escherichia coli, which is applied in the direction of anti-bacterial immunoglobulin, botany equipment and method, biochemical equipment and method, etc., can solve problems such as poor cross-immunity effect, difficulty in vaccine and drug prevention, etc., and achieve Extensive research and commercial use value, good neutralizing activity and protection efficiency, strong sensitivity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Avian Pathogenic Escherichia coli O 78 Preparation of immune antigen of outer membrane protein
[0029] (1) Cloning of outer membrane protein
[0030] Specific primers were designed according to the OMPA gene sequence of Escherichia coli K12W3110 strain (accession number AP009048) in Genebank, the upstream primer introduced the BamHI restriction site, and the downstream primer introduced the XholI restriction site. The upstream primer is: ATTGGATCCGCTCCGAAAGATAACA, and the downstream primer is: TTCTCGAGTTAAGCCTGCGGCTGAGTTA. avian pathogenic Escherichia coli O 78 The genome of the outer membrane protein OMPA was used as template for PCR amplification. The OMPA was connected to pMD18T for sequencing, and the correct OMPA identified by sequencing was double-digested with BamHI and Xhol, cloned into pET-28a(+), transformed into DH5α competent cells, and obtained by kanamycin resistance screening. The positive plasmid pET-28a(+)-OMPA was transformed into Escher...
Embodiment 2
[0035] Example 2 Avian pathogenic Escherichia coli O 78 Preparation of monoclonal antibody against outer membrane protein
[0036] (1) Immunization of BALB / c mice
[0037] Avian pathogenic Escherichia coli O prepared by intraperitoneal injection of 8-week-old BALB / c mice 78 Outer membrane protein Freund's complete adjuvant immunogen 0.5mL / rat; 7d and 14d after immunization, the immunogen in Freund's incomplete adjuvant was boosted with the same method and the same dose.
[0038] (2) Hybridoma cell fusion
[0039] On the third day after the last booster immunization, the splenic lymphocytes of the immunized mice were mixed with myeloma cells SP2 / 0 at a ratio of 4:1, and cell fusion was carried out by using the classic PEG method.
[0040] (3) Screening of hybridoma cells
[0041] After fusion, use HAT as a selective medium, add feeder cells at the same time, distribute in 96-well cell culture plates, and place at 37°C, 5% CO 2 Cultivate in an incubator, observe for 7-10 days...
Embodiment 38A4
[0050] Embodiment 38A4 strain monoclonal antibody specificity test
[0051] avian pathogenic Escherichia coli O 78 , O 1 , O 2 and the standard strain of Salmonella and the screened monoclonal antibody 8A4 strain were used for glass plate agglutination test, and the selected avian pathogenic E. coli O on a small amount of plate was dipped with an inoculation loop 78 , O 1 , O 2 and Salmonella colonies, mixed in normal saline, and then dripped onto the previously marked clean glass slides, and at the same time, drop the monoclonal antibody 8A4 strain to set the avian pathogenic Escherichia coli O 78 , O 1 , O 2 And the control group of Salmonella and saline and monoclonal antibody and saline. The results are shown in Table 1, the results show that the monoclonal antibody has good specificity, only with avian pathogenic Escherichia coli O 78 The reaction was positive, with avian pathogenic Escherichia coli O 1 , O 2 All types were negative, and there was no cross-react...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com