Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Yeast engineered bacteria for expressing recombinant prawn protein Pen9 and its preparation method and uses

A technology of prawn protein and protein, applied in the field of yeast engineering bacteria expressing recombinant prawn protein Pen9 and its preparation and application, which can solve the problems of bacterial drug resistance, residue, affecting product quality and export earnings

Inactive Publication Date: 2010-04-14
WUHAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0014] Pathogenic pathogens are an important factor affecting the development of animal husbandry. The application of traditional antibiotics has led to problems such as bacterial resistance and drug residues, posing a huge threat to human health.
A large number of antibiotics are used as additives in feed, which not only destroys the normal flora in the animals, but also tends to remain in the animals, affecting the quality of products and foreign exchange earnings from exports.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yeast engineered bacteria for expressing recombinant prawn protein Pen9 and its preparation method and uses
  • Yeast engineered bacteria for expressing recombinant prawn protein Pen9 and its preparation method and uses
  • Yeast engineered bacteria for expressing recombinant prawn protein Pen9 and its preparation method and uses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0107] Example 1 Extraction of total RNA of Penaeus vannamei and synthesis of the first strand of cDNA

[0108] The vannamei were reared in an oxygenated water tank at 22°C for use. Select healthy shrimp during the moulting period, rinse with DEPC-treated sterilized water, collect 750 μL of hemolymph from the abdominal sinus of the shrimp with a 2.5 mL disposable syringe, add an equal volume of anticoagulant (pH 7.0), and microscopically examine Counting, take the cell content as 1×10 7 The hemolymph was centrifuged at 4°C and 800 g for 15 min, the supernatant was removed, and the blood cells were collected. Total RNA was extracted according to the product manual of Qiagen's RNeasy Mini Kit. Store the extracted RNA solution at -80°C for future use.

[0109] Using Oligo(dT)15 as a primer, the Universal Riboclone cDNASynthesis System kit from Promega was used to synthesize the first strand of cDNA by reverse transcription according to the operation manual. The specific opera...

Embodiment 2

[0110] Embodiment 2 Amplification of the Penaeidin gene of Penaeus vannamei

[0111] 1. Synthesis of amplification primers

[0112] Design primers, upstream primer P1: 5′ GAATTC GCCATGGGGTACAGGGGCGGTTACACA 3′ (EcoRI site is underlined); downstream primer P2: 5′ TCTAGA GCCTTGTCATCGTCATTCTCTTTTACTAAGTGACAACA 3' (Xbal site underlined). Primers were synthesized by Alpha Company, USA.

[0113] 2. PCR amplification of the target gene

[0114] According to the operation manual of the Reverse Transcription Reaction kit, the target gene Penaeidin was amplified by PCR using the first strand of cDNA synthesized by reverse transcription as a template. PCR reaction system: 10×reaction buffer, 5 μL; 1.5 mM MgCl2, 3 μL; 0.2 mM dNTP, 1 μL; 20 pmol upstream primer P1, 1 μL; 20 pmol downstream primer P2, 1 μL; 5U / μL Taq DNA polymerase 1 μL; template 6 μL; Sterile water to a final volume of 50 µL. PCR reaction conditions: 95°C, 5min; 94°C, 30s; 53°C, 45s; 72°C, 30s (35 cycles); 72°C, 5min...

Embodiment 3

[0116] Construction and identification of embodiment 3 recombinant plasmid pGEM-T / Pen

[0117] 1. Recovery of PCR products

[0118] A DNA gel recovery kit (product of Omega Company) was used to recover PCR product fragments according to the instructions of the DNA gel recovery kit of Omega Company. The specific operation steps are as follows:

[0119] (1) The above PCR product is subjected to 1.2% agarose gel electrophoresis (1×TAE), and the electrophoresis situation is observed with an ultraviolet lamp. When the DNA band to be recovered is completely separated from other bands, the electrophoresis is stopped and cut with a blade under an ultraviolet lamp. The band to be recovered is purified with a PCR product purification kit.

[0120] (2) Crush the glue in an Eppendorf tube, add an equal volume of sol solution Binding Buffer, bathe in water at 65°C for 7 minutes, and shake the Eppendorf tube every 2 minutes until the glue is completely melted.

[0121] (3) Add the melted...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a constructing method and application of yeast gene engineering strain of recombined prawn protein Pen9, which is characterized by the following: coding the nucleic acid and amino acid sequence of recombined prawn protein Pen9; utilizing engineering strain Pichia pastoris X-33(pPIC-pen) with CCTCC No at M206002 to express the recombined prawn protein Pen9; possessing obvious antibiotic activity for Gram-positive bacterium and Gram-negative bacterium; inhibiting influenza virus (A-typed H3N2) from breeding in the chick embryo; treating or preventing animal and plant bacteria, fungi and virus as antiseptic in the cosmetics, food and feed.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and more specifically relates to a genetic engineering strain expressing recombinant prawn protein Pen9, and more specifically relates to a yeast recombinant genetic engineering strain Pichia pastoris X-33 (pPIC-pen) containing prawn peptide gene and prawn peptide The related recombinant prawn protein Pen9, the recombinant prawn protein Pen9 has obvious antibiological activity against Gram-positive bacteria, Gram-negative bacteria and viruses. The invention also relates to a preparation method of the genetically engineered bacterial strain. The recombinant prawn protein Pen9 is used as a preparation for treating or preventing bacteria, fungi and virus diseases of animals and plants, and can be used as a preservative in the fields of cosmetics, food and feed. Background technique [0002] Antimicrobial peptides are a class of small molecular polypeptides produced in the defense system...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435C12N15/12C12N1/19A61K38/17A61P31/00C12R1/84
Inventor 徐进平孟小林王健鲁伟李静
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com