Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit and method for visually detecting trichomonas vaginalis based on RPA-CRISPR-Cas12a system

A technology of rpa-crispr-cas12a and Trichomonas vaginalis, which is applied in the field of medical detection, can solve the problems of low requirements for instruments and equipment, and achieves the effects of low requirements for equipment, avoiding pollution and high sensitivity

Pending Publication Date: 2022-07-22
JILIN UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

RPA belongs to the isothermal amplification technology, which has low requirements on instruments and equipment. It only needs a constant temperature water bath to complete the reaction without precision instruments, but it has the disadvantages of being prone to false positives.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for visually detecting trichomonas vaginalis based on RPA-CRISPR-Cas12a system
  • Kit and method for visually detecting trichomonas vaginalis based on RPA-CRISPR-Cas12a system
  • Kit and method for visually detecting trichomonas vaginalis based on RPA-CRISPR-Cas12a system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] CRISPR-Cas12a recombinant protein expression, purification and activity detection methods:

[0042] 1. Inducible expression of CRISPR Cas12a protein;

[0043] (1) The CRISPR-Cas12a gene was connected to the prokaryotic expression vector pGEX-4T-1, and the ligated product was transferred into the expression competent BL21, and the positive colonies were picked and placed in the LB culture after pre-packing and autoclaving base (5mL / tube), add 5μl ampicillin at the same time; transfer to 37°C constant temperature shaking incubator, 150r / min, shake overnight;

[0044] (2) Transfer the bacterial liquid that was shaken overnight to 300 mL of LB medium after autoclaving, add 300 μL of ampicillin, seal it and transfer it to a 37°C constant temperature shaking incubator for constant temperature shaking culture for 1.5h to 2h, the OD value about 0.6;

[0045] (3) Add 300 μl of IPTG for induction, transfer to a constant temperature shaking incubator at 16°C, centrifuge at 12000...

Embodiment 2

[0072] Selection of Trichomonas vaginalis target gene, crRNA design and RPA primer screening method:

[0073] 1. Trichomonas vaginalis target gene selection and crRNA design;

[0074] (1) Acquisition of Trichomonas vaginalis target gene information: actin gene is highly conserved in Trichomonas vaginalis, and is often used in genotyping and etiological detection in clinic. Therefore, this method selects the actin gene to select Trichomonas vaginalis to be detected. target sequence, and BLAST is performed simultaneously to prove its specificity;

[0075] (2) Target DNA synthesis: According to the T-rich feature of Cas12a, three conserved region cleavage sites were designed, and F and R of the target DNA were annealed to synthesize double-stranded target DNA. Its specific sequence is shown in SEQ ID NO:1-NO:3;

[0076] (3) T7 promoter (TAATACGACTCACTATAGG) + scaffold sequence of LbCas12a (aatttctactaagtgtagat) + target sequence (20-23bp after the target DNAPAM sequence) was us...

Embodiment 3

[0095] Methods for evaluating the sensitivity and specificity of CRISPR-Cas12a combined with RPA for TV detection:

[0096] 1. The specificity experiment of CRISPR-Cas12a combined with RPA for TV detection;

[0097] (1) In accordance with the blood and tissue sample genomic DNA extraction kit (DP304-02), for Trichomonas vaginalis, Candida albicans, Mycoplasma hominis, Neisseria gonorrhoeae, Escherichia coli, Human Genome, Cryptosporidium, Giardia Genomes of common pathogenic microorganisms including Toxoplasma gondii and Toxoplasma gondii were extracted and quantified using Nanodrop;

[0098] (2) Using the RPA primers screened in Example 2 to amplify the gene product to be detected, the RPA reaction system is 20 μL: including the RPA upstream amplification primer 0.50 μM, the RPA downstream amplification primer 0.50 μM, 1×Rehydration Buffer, 14mMMgOAc, The genomic DNA of the sample to be tested is 2 μL, and the rest is supplemented with 20 μL of water. RPA amplification proc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit and a method for visually detecting trichomonad vaginalis based on an RPA-CRISPR-Cas12a system, the kit comprises a pair of specific RPA primer pairs for amplifying actin genes of trichomonad vaginalis, crRNA for CRISPRCas12a reaction, a fluorescent reporter group, a lateral flow immunochromatography reporter group and a Cas12 / 13 universal lateral flow chromatography test strip, the buffer solution and the Cas12a protein are used for CRISPR (clustered regularly interspaced short palindromic repeats) reaction, nucleotide sequences of a specific RPA (recombinase polymerase amplification) primer pair for amplifying actin genes of trichomonad vaginalis are shown as SEQ ID NO: 11 and 16, and a nucleotide sequence of DNA (deoxyribonucleic acid) complementary with crRNA (complementary ribosomal ribonucleic acid) for CRISPR Cas12a reaction is shown as SEQ ID NO: 5; the method is rapid, visible, good in specificity and high in sensitivity, can be used as a tool for clinical detection of trichomonad vaginalis, has low requirements on equipment, is particularly suitable for large-scale population screening, and provides a good technical means for monitoring of public health institutions.

Description

technical field [0001] The invention relates to the field of medical detection, in particular to a kit and method for visual detection of Trichomonas vaginalis based on an RPA-CRISPR-Cas12a system. Background technique [0002] Trichomonas vaginalis (TV) is an extracellular parasite belonging to the unicellular flagellate protozoan parasite and is a microaerophilic parasite. The pathogenesis of TV is mainly: killing of host cells by parasites, disruption of vaginal microbial homeostasis, inflammation by activating host immune responses, and immune evasion reaction etc. After Trichomonas vaginalis invades the reproductive system or urinary system, it will induce infection in both men and women, resulting in more serious consequences. The disease can present with genital symptoms, including vaginal erythema, itching, and odor, a gray-green or yellow-green discharge, and difficulty urinating. In female infection, in addition to causing vaginitis, cervicitis, urethritis, infe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6893C12Q1/6804C12Q1/6844C12N15/11C12R1/90
CPCC12Q1/6893C12Q1/6804C12Q1/6844C12Q2521/327C12Q2525/151C12Q2525/161C12Q2563/131C12Q2565/625C12Q2563/107C12Q2521/507C12Q2531/119
Inventor 宫鹏涛李珊曹松高姜维娜李建华张西臣于艳辉曹利利李新王晓岑
Owner JILIN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More