Kit and method for visually detecting trichomonas vaginalis based on RPA-CRISPR-Cas12a system
A technology of rpa-crispr-cas12a and Trichomonas vaginalis, which is applied in the field of medical detection, can solve the problems of low requirements for instruments and equipment, and achieves the effects of low requirements for equipment, avoiding pollution and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] CRISPR-Cas12a recombinant protein expression, purification and activity detection methods:
[0042] 1. Inducible expression of CRISPR Cas12a protein;
[0043] (1) The CRISPR-Cas12a gene was connected to the prokaryotic expression vector pGEX-4T-1, and the ligated product was transferred into the expression competent BL21, and the positive colonies were picked and placed in the LB culture after pre-packing and autoclaving base (5mL / tube), add 5μl ampicillin at the same time; transfer to 37°C constant temperature shaking incubator, 150r / min, shake overnight;
[0044] (2) Transfer the bacterial liquid that was shaken overnight to 300 mL of LB medium after autoclaving, add 300 μL of ampicillin, seal it and transfer it to a 37°C constant temperature shaking incubator for constant temperature shaking culture for 1.5h to 2h, the OD value about 0.6;
[0045] (3) Add 300 μl of IPTG for induction, transfer to a constant temperature shaking incubator at 16°C, centrifuge at 12000...
Embodiment 2
[0072] Selection of Trichomonas vaginalis target gene, crRNA design and RPA primer screening method:
[0073] 1. Trichomonas vaginalis target gene selection and crRNA design;
[0074] (1) Acquisition of Trichomonas vaginalis target gene information: actin gene is highly conserved in Trichomonas vaginalis, and is often used in genotyping and etiological detection in clinic. Therefore, this method selects the actin gene to select Trichomonas vaginalis to be detected. target sequence, and BLAST is performed simultaneously to prove its specificity;
[0075] (2) Target DNA synthesis: According to the T-rich feature of Cas12a, three conserved region cleavage sites were designed, and F and R of the target DNA were annealed to synthesize double-stranded target DNA. Its specific sequence is shown in SEQ ID NO:1-NO:3;
[0076] (3) T7 promoter (TAATACGACTCACTATAGG) + scaffold sequence of LbCas12a (aatttctactaagtgtagat) + target sequence (20-23bp after the target DNAPAM sequence) was us...
Embodiment 3
[0095] Methods for evaluating the sensitivity and specificity of CRISPR-Cas12a combined with RPA for TV detection:
[0096] 1. The specificity experiment of CRISPR-Cas12a combined with RPA for TV detection;
[0097] (1) In accordance with the blood and tissue sample genomic DNA extraction kit (DP304-02), for Trichomonas vaginalis, Candida albicans, Mycoplasma hominis, Neisseria gonorrhoeae, Escherichia coli, Human Genome, Cryptosporidium, Giardia Genomes of common pathogenic microorganisms including Toxoplasma gondii and Toxoplasma gondii were extracted and quantified using Nanodrop;
[0098] (2) Using the RPA primers screened in Example 2 to amplify the gene product to be detected, the RPA reaction system is 20 μL: including the RPA upstream amplification primer 0.50 μM, the RPA downstream amplification primer 0.50 μM, 1×Rehydration Buffer, 14mMMgOAc, The genomic DNA of the sample to be tested is 2 μL, and the rest is supplemented with 20 μL of water. RPA amplification proc...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com