Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

STAT2 gene deletion cell strain as well as preparation method and application thereof

A gene deletion and cell line technology, applied in the fields of molecular biology and genetics, can solve the problems of host cell tumorigenic risk, low efficiency of packaging virus, low efficiency of toxin production, etc., and achieve high knockout efficiency and strong reproducibility , the effect of reducing production costs

Pending Publication Date: 2022-04-15
北京镁伽科技有限公司
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a STAT2 gene-deficient cell line, a construction method, an application, and a method for packaging a virus in order to overcome the problems in the prior art such as low efficiency of toxin production, low efficiency of packaging virus, and risk of tumorigenesis in host cells. , the cell line is a cell line with STAT2 gene deletion. When used in packaging virus, it can package virus stably and efficiently, and the virus titer is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • STAT2 gene deletion cell strain as well as preparation method and application thereof
  • STAT2 gene deletion cell strain as well as preparation method and application thereof
  • STAT2 gene deletion cell strain as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0092] The preparation method of the linear PUC-sgRNA plasmid is as follows: digest the PUC-sgRNA plasmid with BbsI.

[0093] The transformation and identification of sgRNA1 expression vectors and sgRNA2 expression vectors are carried out according to the following methods:

[0094] (1) Bacterial transformation

[0095] Preparation (~30 minutes in advance): take out the competent cells Trans-T1 (purchased from Quanshijin Company) stored in EP tubes from the -80°C refrigerator (100 μL per tube), and put them on ice to thaw (about 15 minutes) Finally, divide half (50 μL) of each tube into a new EP tube; turn on two water baths at 42 °C and 37 °C; take the resistant (Amp+) LB solid medium and put it in a 37 °C incubator to preheat.

[0096] Each tube of competent cells Trans-T1 (50 μL) was operated as follows: add 10 μL plasmid (i.e. sgRNA1 expression vector or sgRNA2 expression vector or reporter vector), place it on ice for 10 min, put it in a 42°C water bath, heat shock for 4...

Embodiment 1

[0102] This example is used to illustrate the cell line and its construction of STAT2 gene deletion

[0103] (1) STAT2 gene primer design

[0104] According to the STAT2 gene of HEK293 cells (STAT2 genome sequence NCBI ID: U18671.1), the primers in Table 1 were designed, and the primers were available (683bp) after PCR verification (such as figure 1 shown).

[0105] Table 1

[0106] Upstream primer: SEQ ID NO.:1(5'-3') TTGGGAACCCTCATCCTTCT Downstream primer: SEQ ID NO.:2(5'-3') CTTTGTCTTTTTCACCATAGC

[0107] (2) Construction of sgRNA1 expression vector and sgRNA2 expression vector

[0108] (a) sgRNA primer annealing (sgRNA primers annealling)

[0109] Two sgRNA targets were designed according to the STAT2 genome sequence, namely the sgRNA1 target sequence (SEQ ID NO.:3, GGAGGCTGTGCGAGTAAAGCTGG) and the sgRNA2 target sequence ((SEQ ID NO.:4, GATCAGCTGAACTATGAGTGTGG). A pair was synthesized according to the designed target sequence Primers (as shown i...

Embodiment 2

[0159] This example is used to illustrate the use of the HEK293 cell line with STAT2 gene deletion for virus packaging and effect verification.

[0160] (1) Lentiviral packaging

[0161] STAT2 gene-deleted HEK293 cells of the present invention were inoculated into 6-well plates for culturing as experimental group 1, and 293T cells (purchased from the Cell Bank of the Chinese Academy of Medical Sciences, GNHu17) were inoculated into 6-well plates for comparison as experimental group 2. Wild-type HEK293 cells were inoculated into 6-well plates for culture as experimental group 3. 24 hours before transfection, three groups of cells were plated with the same cell density (1x10 6 cells / well), when the cell density of the three groups reached about 80% confluence, the lentiviral plasmid packaging verification was carried out. The commercially available lentiviral packaging plasmid system (main plasmid PLVX-mCherry-C1, auxiliary plasmids PLP1, PLP2, PLP-VSVG, were purchased from Zh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology and genetics, and discloses an STAT2 gene deletion cell strain as well as a preparation method and application thereof. The stable cell strain is established by selecting the HEK293 cell, and has the advantages of high virus yield and no tumorigenicity, the virus production and preparation time is saved, the virus recovery efficiency is improved, and the production cost is reduced. The CRISPR / Cas9 technology is utilized to perform specific targeted knockout on the STAT2 gene of the cell to obtain the STAT2 gene deleted cell strain, the method is simple, the replicability is strong, the knockout efficiency is extremely high, and in a preferred implementation scheme, by utilizing a gene knockout system containing a reporter vector, target cells can be quickly and intuitively screened.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and genetics, in particular to a STAT2 gene deletion cell line and its preparation method and application. Background technique [0002] CRISPR-Cas9 is an adaptive immune defense formed during the long-term evolution of bacteria and archaea, which can be used to fight against invading viruses and foreign DNA. The CRISPR-Cas9 gene editing technology is a technology for specific DNA modification of targeted genes, and this technology is also a cutting-edge method for gene editing. The principle and core key technology of the present invention is that a Cas9 nuclease can recognize and cut target double-stranded DNA by using a guide RNA (gRNA). Due to many advantages such as high mutation efficiency, low cost, and wide application range, this technology is one of the most promising gene therapy technologies for clinical and application. [0003] Virus packaging is the process of using tra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/85C12N15/65C12N9/22C12N15/113C12N15/867C12N7/00C12R1/93
Inventor 许傲天白晓张起起
Owner 北京镁伽科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com