Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene-deleted attenuated African swine fever virus strain and application thereof

An African swine fever virus, African swine fever technology, which is applied in the field of bioengineering and can solve the problems of reduced immunogenicity or protective effect of attenuated strains, complicated operation, and large engineering.

Inactive Publication Date: 2021-06-25
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, the virulence gene knockout vaccine of classical swine fever virus still has the following problems: ① Different strains have different effects of deleting the same gene. Low titer will also reduce the risk of immunogenicity or protective effect of the attenuated virus strain; ② There are many virulence genes knocked out, not only the operation is complicated and the cost is high, but also whether the gene knockout is successful must also be considered. The more genes that are knocked out, the lower the success rate of gene knockout is likely to be. Once the knockout is incomplete, it will cause safety problems; ③Although the whole genome sequencing of African swine fever has been completed, the composition of the African swine fever virus There are more than 150 regulatory genes and structural genes. Although a comprehensive study of the function of each regulatory gene and structural gene is crucial to its pathogenic mechanism and vaccine development, the project is relatively large and requires huge human and financial resources.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene-deleted attenuated African swine fever virus strain and application thereof
  • Gene-deleted attenuated African swine fever virus strain and application thereof
  • Gene-deleted attenuated African swine fever virus strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Construction and purification identification of embodiment 1 recombinant virus MGF-Δ7R

[0053] 1. CRISPR / Cas9 vector construction

[0054] (1) pX330 vector optimization: Since African swine fever virus mainly replicates in the cytoplasmic virus factory, pX330 was first optimized when constructing the pCRISPR / Cas9 vector; the nuclei at both ends of the Cas9 enzyme were removed by ClonExpress II one-step cloning method Localization signal (NLS), named pX330ΔN.

[0055] (2) Design targeting gRNAs for ASFV MGF-505-7R gene, its oligonucleotide name and sequence are respectively: MGF5057R-gRNA-LF:AAAATCACTTGGAAGGAAGAAGG (shown in SEQ ID NO.3) and MGF5057R-gRNA-RF : CATGGCATACTCCAAAGCATAGG (shown in SEQ ID NO.4).

[0056] (3) Refer to the cloning method recommended by the literature (Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genomeengineering using the CRISPR-Cas9 system. NatProtoc.2013; 8(11):2281-2308), The oligonucleotides MGF5057R-gRNA-LF and MGF5057R-gR...

Embodiment 2

[0068] Example 2 ASFV MGF-505-7R immunosuppressive experiment

[0069] HEK293 cells in good condition were digested with trypsin and spread on a 48-well plate, placed at 37°C, 5% CO 2 Cells were cultured in an incubator for 12 hours, and Lipofectamine TM 2000 transfection was performed when the cell density was nearly 70%-80%. 100ng of IFN-β reporter plasmid, 10ng of internal reference plasmid TK, and 100ng of MGF-505-7R plasmid ( The ASFV MGF-505-7R gene was inserted into the pCMV plasmid to obtain the pCMV-MGF-505-7R plasmid) and the cGAS+MITA plasmid were synchronously transfected into HEK293 cells for 12 hours. Three parallel holes were set up in the experiment to ensure the reliability of the experimental results. Add 50 μL of 1×passive lysis buffer to each well to lyse at room temperature for 15-20min, and detect the activity of the dual luciferase reporter gene after sufficient lysis. The result is as Figure 5 As shown, among them, the abscissa is different plasmids...

Embodiment 3

[0070] The titration of embodiment 3 virus titers

[0071] The titration of African swine fever virus adopts the half hematosorbate amount (50% haemadsorption, HAD 50 ) method to operate. References (Borca MV, Ramirez-Medina E, Silva E, Vuono E, Rai A, Pruitt S, Holinka LG, Velazquez-Salinas L, Zhu J, Gladue DP. Development of a highly effective African swine fever virus vaccine by deletion of the I177L Generesults in sterile immunity against the current epidemic Eurasiastrain.JVirol.2020.pii:JVI.02017-19) carry out HAD 50 Experimental operation, and make appropriate adjustments: Inoculate primary PBMCs in 96-well cell culture plates (Mason, D.W., W.J. Penhale, and J.D. Sedgwick, 1987: Preparation of lymphocytes subpopulations. In: Klaus, G.G.B. (ed.) Lymphocytes: a Practical Approach , pp.35-54.IRL Press, Oxford.), the sample to be tested was diluted 10 times, and 0.02ml was inoculated in each well. The virus infection can be judged by the rosette formed by the aggregation ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of bio-engineering, and particularly relates to an innate immunosuppressive gene-deleted attenuated African swine fever virus strain and application thereof. According to the invention, ASFV MGF-505-7R is found to be capable of inhibiting the generation of interferon. The ASFV MGF-505-7R gene is deleted from an original African swine fever virus strain, the attenuated African swine fever virus strain with good safety is obtained, and a theoretical basis and a practical reference are provided for successfully preparing an African swine fever vaccine in the future. Furthermore, a researcher can knock out ASFV MGF-505-7R and one or more disclosed virulence genes (such as CD2V, MGF360-12L, MGF360-13L, MGF360-14L, MGF360-505R and the like) at the same time, and finally, a safe and effective candidate strain of the African swine fever vaccine is prepared.

Description

[0001] This application claims the priority of the earlier application with the application date of May 1, 2020, the application number CN 2020103686761, and the invention titled "A Gene-deleted Attenuated African Swine Fever Virus Strain and Its Application". The entire content of has been embodied in this application. technical field [0002] The invention belongs to the technical field of bioengineering, and in particular relates to a gene-deleted attenuated African swine fever virus strain and its application. Background technique [0003] African swine fever (African swine fever, ASF) is caused by the infection of African swine fever virus (ASFV), and is characterized by fever and hemorrhage in pigs. The fatality rate for domestic pigs is as high as 100%. . The disease first broke out in Kenya in 1921 and subsequently became widespread among domestic and wild pigs throughout Africa. It was introduced into Europe in the 1950s, and it took 40 years to eliminate the dise...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/34C12N7/04A61K39/12A61P31/20
CPCA61K39/12A61K2039/5254A61K2039/552A61P31/20C07K14/005C12N7/00C12N2710/12021C12N2710/12022C12N2710/12034
Inventor 郑海学李丹李攀齐晓兰茹毅张克山张敬冯涛田宏杨帆杨吉飞刘志杰郭建宏孙研殷宏党文刘湘涛
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com