Novel E-type aviadenovirus Fiber fluorescent quantitative PCR detection kit and application thereof
An avian adenovirus, fluorescence quantitative technology, applied in the direction of microbial determination/inspection, DNA/RNA fragment, recombinant DNA technology, etc., can solve problems such as new adenovirus infection, achieve good primer specificity, convenient sampling, good stability Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Establishment of fluorescent PCR detection method
[0034] Virus strains, standard plasmids
[0035] The AH720-8a strain virus was preserved by our laboratory, and the recombinant plasmid pUC57-Fiber (AH720 8a) was synthesized by Shanghai Sangong.
[0036] Main Reagents and Instruments
[0037] DL 500 DNA Marker, AceQ U + Probe Master Mix was purchased from Novozyme, TIANamp virus genome extraction kit was purchased from QIANGEN; Applied Biosystems QS 5 fluorescent quantitative PCR instrument.
[0038] Primer Design for Standard Plasmid Preparation
[0039] Referring to the 30716~30796 bp of the AH720-8a gene (ID: MN226943.1) in GenBank, the specific primer AH720-8a-F was designed: 5'- GGGAGGTCTAAATTCCCAATCC -3' (SEQ ID No.1), AH720-8a - R : 5'- GTTGTAGACAGTGGACCGTTAG -3' (SEQ ID No.2) and probe AH720-8a-Probe: 5'6 FAM-AGTTGATAACGGCGCACTCGATGT- -3' BHQ1-N (SEQ ID No.3), the target fragment is 114 bp; The molecular weight of the recombinant plasmid pUC57-...
Embodiment 2
[0051] Example 2 Sensitivity and repeatability verification of fluorescent PCR detection method
[0052] will be 2.93×10 8 copies / μL~2.93×10 1 The standard plasmid at the concentration of copies / μL was used as a template to carry out qPCR test according to the optimized reaction conditions, and the detection sensitivity was 2.93×10 8 Copies / μL~2.93×10 2 Copies / μL concentration plasmid was used as a template for qPCR reaction, and each concentration gradient was repeated three times. The standard curve was drawn with the obtained Ct value and the coefficient of variation (CV) was calculated to evaluate the repeatability of the method. The results are shown in Table 3. It can be seen from Table 3 that the CV (the ratio of the standard deviation to the mean) is less than 2%, indicating that the established method has good repeatability and stable results. Depend on figure 2 It can be seen from Table 3 that the lowest plasmid concentration that can be detected by the estab...
Embodiment 3
[0056] Example 3 Specific verification of fluorescent PCR detection method
[0057] DNA or cDNA for common infectious pathogens include: chicken Marek's virus (MDV) Md5 virulent strain, type I duck viral hepatitis virus (DHV), duck Tambusu virus (DTMUV), chicken infectious anemia virus (CIA) , avian Escherichia coli (E.coli), serotype 4 avian adenovirus (FADV-4), Mycoplasma gallisepticum (MG), Mycoplasma gallisepticum (MS), etc. for qPCR detection to evaluate the specificity of primers and probes sex. Depend on image 3 It can be seen that: MDV, DHV, CIA, E.coli, DTMUV, MG, MS, serotype 4 avian adenovirus, and virus-free water are all negative, and only AH720-8a has a fluorescent reporter signal, indicating that the detection method has good specificity. sex.
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
PCR efficiency | aaaaa | aaaaa |
Dilution degree | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com