Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cell line for knocking out porcine IRF8 gene based on CRISPR-Cas9 editing technology and construction method of cell line

A cell line and gene technology, applied in other methods of inserting foreign genetic material, cells modified by introducing foreign genetic material, genetic engineering, etc., can solve the problem that there is no porcine IRF8 gene intestinal epithelial cell model, etc. Simple and efficient knockout effect

Pending Publication Date: 2020-09-01
YANGZHOU UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no pig IRF8 gene knockout vector and IRF8 gene knockout small intestinal epithelial cell model

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell line for knocking out porcine IRF8 gene based on CRISPR-Cas9 editing technology and construction method of cell line
  • Cell line for knocking out porcine IRF8 gene based on CRISPR-Cas9 editing technology and construction method of cell line
  • Cell line for knocking out porcine IRF8 gene based on CRISPR-Cas9 editing technology and construction method of cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] 1. Target site design and sgRNA sequence synthesis:

[0050] According to the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), the transcript CDS sequence of the porcine IRF8 gene (accession number: NM_001252427.2) was obtained, and the knockout target site was designed according to the 5' end of the CDS region , using CRISPRDesign (http: / / crispr.mit.edu / ) to design three sgRNA guide sequences sgRNA1, sgRNA2 and sgRNA3,

[0051] sgRNA1: CCGTTCCGGTCGCACATCCTCGG;

[0052] sgRNA2: aggATGTGCGACCGGAACGGCGG;

[0053] sgRNA3: GGATCCGGAACATGCTCTTCTGG.

[0054] Add base CACC to the 5' end of the three sgRNA guide sequences and remove the PAM (NGG) sequence at the 3' end to form a positive-strand sgRNA sequence (note that if the first base at the 5' end of the sgRNA sequence is not G, you need to Add CACCG, the first base is G, only need to add CACC); reverse complement the three sgRNA guide sequences designed, and add base AAAC to the 5' end to form a negative strand sgRNA sequ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cell line for knocking out the porcine IRF8 gene based on a CRISPR-Cas9 editing technology and a construction method of the cell line. The cell line is prepared by adopting the following steps of: (1) design of a target site and synthesis of an sgRNA sequence: designing an sgRNA guide sequence according to the 5' end of a CDS region of the porcine IRF8 gene; (2) vector construction: annealing the plus-strand sgRNA sequence and the minus-strand sgRNA sequence to form double-stranded DNA; connecting the double-stranded DNA with a linearized pGK1.1 vector to obtain a positive targeting vector; and (3) cell transfection: carrying out mixed electrotransfection of the positive targeting vector into the target cell IPEC-J2 to obtain the IPEC-J2 cell with the IRF8 gene knocked out. The small intestine epithelial cell line with the IRF8 gene knocked out is established, and a more direct and effective research model can be provided for deep revealing of a diarrhea pathogen pathogenic mechanism, resistance gene mining and identification and cultivation and application of diarrhea-resistant transgenic pigs.

Description

technical field [0001] The invention relates to a cell line and a construction method thereof for specifically targeting and knocking out the pig IRF8 gene by using CRISPR-Cas9. Background technique [0002] The CRISPR-Cas9 system is an acquired immune system formed during the long-term evolution of bacteria and archaea, which can form a specific defense mechanism against gene introduction caused by phage infection, plasmid binding and transformation. The principle and core key technology of the present invention is that a Cas9 nuclease can recognize and cut target double-stranded DNA by using a guide RNA (gRNA). Due to many advantages such as high mutation efficiency, low cost, and wide application range, this technology is one of the most promising gene therapy technologies for clinical and application. [0003] Porcine intestinal epithelial cells (IPEC-J2) is a non-transformed intestinal cell line derived from jejunum epithelial cells, which provides a biologically relev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/90C12N5/10
CPCC12N15/113C12N15/907C07K14/4702C12N2310/20
Inventor 包文斌宗秋芳殷宗俊王海飞吴圣龙
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com