Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cow lysozyme (Lyz) gene mammary gland specific expression recombinant plasmid as well as construction method and application thereof

A technology of recombinant plasmids and construction methods, which can be applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as drug-resistant strains endangering consumers' health, and difficult problems in the treatment of dairy cow mastitis, so as to treat and prevent mastitis, improve bacteriolysis The effect of enzyme expression and high sensitivity

Inactive Publication Date: 2019-12-24
YANGZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the main treatment methods are antibiotics and traditional Chinese medicine preparations. However, the use of antibiotics, the emergence of drug-resistant strains and drug residues in milk seriously endanger the health of consumers. Therefore, the treatment of cow mastitis has become a difficult problem in the world.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cow lysozyme (Lyz) gene mammary gland specific expression recombinant plasmid as well as construction method and application thereof
  • Cow lysozyme (Lyz) gene mammary gland specific expression recombinant plasmid as well as construction method and application thereof
  • Cow lysozyme (Lyz) gene mammary gland specific expression recombinant plasmid as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] 1. Primer design and synthesis

[0047] According to the cDNA sequence of dairy cow Lyz gene in GenBank (GenBank No.: NM_180999.1) and β-lactoglobulin (BLG) gene sequence (GenBank No.: X14710.1), Oligo6.0 was used to design cow Lyz gene primers P1, P2, and β-lactoglobulin gene (BLG) promoter gene primers P3 and P4 were synthesized by Beijing Qingke Xinye Biotechnology Co., Ltd. The sequences are respectively (the underline is the homology arm):

[0048] P1: CTCAGATCTCGAGCTCAAGCTT CATGAAGGCTCTCCTCATT

[0049] P2: CATGGTGGCGACCGGTGGATCC CACTCCACAACCCTGAAT

[0050] P3: GCCATGCATTAGTTATTAAT AGGTGCTTTATTTCCGTCTC

[0051] P4: TGAGGAGAGCCTTCATAAGCT TACAGCCTCCCTTGGTCTC

[0052] 2. Acquisition of gene cloning template

[0053] (1) Genomic DNA extraction from dairy cow blood

[0054] Take 9ml fresh and healthy Chinese Holstein cow blood samples, and extract cow blood genomic DNA according to the operation method of the Whole Blood Genomic DNA Extraction Kit (purchas...

Embodiment 2

[0067] 1. Culture and count of Staphylococcus aureus strain (S.aureus)

[0068] Resuscitate the frozen Staphylococcus aureus, inoculate the LB medium with an inoculation loop, and put it into a 37°C constant temperature biochemical incubator for overnight culture; pick a single colony from the LB medium and inoculate it in the LB medium, put Into 37 ℃ constant temperature air bath shaker overnight culture. Collect the strains, resuspend the bacteria with DMEM high-sugar medium to make a bacterial suspension, and adjust the concentration of the bacterial suspension to 2×10 8 cfu / mL.

[0069] 2. Antibacterial effect of S.aureus challenged in vitro cultured dairy cow mammary epithelial cells

[0070] (1) Experimental grouping

[0071] The primary cultured dairy cow mammary gland epithelial cells were inoculated into 6-well cell culture plates and placed in CO 2 Cultivate in a constant temperature incubator. When the cells grow to 80% confluence, carry out the experimental gro...

Embodiment 3

[0084] 1. Transfection of Lyz recombinant plasmid in mice

[0085] (1) Experimental grouping

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a cow lysozyme (Lyz) gene mammary gland specific expression plasmid as well as a construction method and application thereof. Specifically, a coding sequence of a Lyz gene is subjected to PCR amplification, the Lyz gene is inserted into a multiple cloning site of a universal expression vector pEGFP-N1 carrying an enhanced green fluorescent protein gene; Ase I+Hind III doubleenzyme digestion is conducted on the universal expression vector pEGFP-N1 so as to remove a CMV promoter, a cow mammary gland specific expression beta-lactoglobulin gene (BLG) promoter sequence is cloned, Ase I and HindIII restriction enzyme cutting sites are replaced, and the cow Lyz gene mammary gland specific expression plasmid is constructed. The recombinant plasmid is adopted to transfect cow mammary epithelial cells, and an obtained cell line can be used for secreting cow lysozyme with biological activity and used for cow mammary tissue immune mechanism research; and the recombinant plasmid can also be applied to research and development of preparations for gene therapy of cow mastitis.

Description

technical field [0001] The invention relates to a mammary gland-specific expression recombinant plasmid of cow lysozyme gene and its construction method and application, belonging to the technical field of gene recombination and molecular cloning. Background technique [0002] Dairy cow mastitis is a common and frequently-occurring disease in dairy cows. As the incidence of dairy cow mastitis increases, the milk production of dairy cows will be greatly reduced, and the quality of raw milk will be seriously affected. Therefore, the treatment of cow mastitis is getting more and more attention. At present, the main treatment methods are antibiotics and traditional Chinese medicine preparations. The use of antibiotics, the generation of drug-resistant strains and drug residues in milk seriously endanger the health of consumers. Therefore, the treatment of cow mastitis has become a difficult problem in the world. Use less or no antibiotics, effectively control drug residues, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/65C12N15/56A61P15/14
CPCA01K2207/05A01K2227/101A01K2267/02A61P15/14C12N9/2462C12N15/65C12N15/85C12N15/8509C12N2800/107C12Y302/01017
Inventor 杨章平张志鹏杨奕陈代杰张慧敏
Owner YANGZHOU UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More