Chimeric antigen receptor targeting BCMA and application thereof
A chimeric antigen receptor and targeting technology, applied in the field of tumor cell immunotherapy, can solve the problems of unstable treatment effect and unpredictable treatment effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Design of chimeric antigen receptor
[0058] In this example, an anti-BCMA chimeric antigen receptor (G8 CAR) was constructed, as shown in the sequence diagram figure 1 As shown, the chimeric antigen receptor includes a CD8α signal peptide sequence (Leader), a single domain antibody sequence (Anti-BCMA VHH) that specifically binds to the BCMA antigen, CD8α hinge region (Hinge) and transmembrane region sequences (Transmembrane), 4-1BB costimulatory domain sequence and CD3ζ signaling domain sequence, the specific partial sequences are as follows:
[0059] CD8α signal peptide (leader) amino acid sequence (SEQ ID NO. 5): MALPVTALLLPLALLLHAARP;
[0060] CD8α signal peptide (leader) nucleotide sequence (SEQ ID NO.6): ATGGCACTGCCAGTGACAGCCCTGCTGCTGCCACTGGCCCTGCTGCTGCA CGCAGCACGCCCT;
[0061] The amino acid sequence (SEQ ID NO.7) of the hinge region (hinge) of CD8α: TTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACD;
[0062] The nucleotide sequence of the hinge region of CD8α (SE...
Embodiment 2
[0069] Example 2: Construction of anti-BCMA chimeric antigen receptor expression vector
[0070] (1) Complete gene synthesis of G8 CAR sequence, digest the fully synthesized G8 CAR and empty vector with EcoRI and BamHI. After digestion in 37℃ water bath for 30 minutes, use 1.5% agarose gel for DNA electrophoresis, then Use Tiangen's agarose gel kit for purification and recovery;
[0071] (2) The connection of pCDH-EF1-MCS vector and G8 CAR gene fragment:
[0072] The connection system is as follows:
[0073] Component
Adding amount (μl)
PCDH-EF1-MCS vector
2(50ng)
G8 CAR gene
10(150ng)
2
T4 DNA Ligase (NEB)
1
dd H 2 O
5
In total
20
[0074] After ligation at 22°C for 1 hour, the ligation product was directly transformed into Stbl3 E. coli competent cells. 200 μl of the transformed product was coated on an ampicillin-resistant LB plate. The LB plate was cultured upside down in an incubator at 37°C overnight. Three single clones were randomly sele...
Embodiment 3
[0076] Example 3: Lentivirus packaging
[0077] The lentiviral expression vectors in the examples were separately packaged with a four-plasmid system. The specific steps are as follows:
[0078] (1) The four-plasmid system expresses the gag / pol, Rev, VSV-G required for lentiviral vector packaging and the artificial chimeric antigen receptor composed of the engineered stable single-chain antibody of the present invention: the four plasmids are transiently transfected into 293T Cells, the total mass is 10μg;
[0079] (2) Add the above plasmid to a certain volume of serum-free DMEM, mix well and leave it for 15 minutes, add the above mixture to the T75 culture flask with 293T cells, mix gently, and hold at 37°C. , 5% CO 2 Culture in a cell incubator for 6 hours;
[0080] (3) After 6 hours, replace the fresh medium, continue the culture, and add 10 mM sodium butyrate solution. After 72 hours, collect the culture supernatant of the lentivirus for purification detection.
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap