Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A chimeric antigen receptor targeting bcma and its application

A chimeric antigen receptor and targeting technology, applied in the field of tumor cell immunotherapy, can solve the problems of unpredictable and unstable therapeutic effects

Active Publication Date: 2020-06-09
GUANGZHOU BIO GENE TECH CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the development of technology, cells expressing chimeric antigen receptor (CAR) modifications have been used for treatment, but the therapeutic effect of the established antigen-binding domain used in CAR is unpredictable, resulting in unstable therapeutic effect
[0004] The use of BCMA antigens as ectodomains for the treatment of B cell-related diseases has been disclosed, but if the antigen-binding domain binds too strongly, then CAR T cells induce a large-scale release of cytokines, resulting in a potentially fatal disease that is regarded as a "cytokine storm". Immune response; however, if the antigen-binding domain binds too weakly, CAR T cells may not be sufficiently therapeutically effective in eradicating cancer cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A chimeric antigen receptor targeting bcma and its application
  • A chimeric antigen receptor targeting bcma and its application
  • A chimeric antigen receptor targeting bcma and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Design of Chimeric Antigen Receptors

[0058] This example constructs an anti-BCMA chimeric antigen receptor (G8 CAR), as shown in the sequence diagram figure 1 As shown, the chimeric antigen receptor includes a signal peptide sequence (Leader) of CD8α, a single domain antibody sequence (Anti-BCMA VHH) specifically binding to BCMA antigen, a hinge region (Hinge) and a transmembrane region sequence of CD8α (Transmembrane), 4-1BB co-stimulatory domain sequence and CD3ζ signaling domain sequence, the specific sequences of each part are as follows:

[0059] Amino acid sequence (SEQ ID NO.5) of CD8α signal peptide (leader): MALPVTALLLPLALLLLHAARP;

[0060] The nucleotide sequence (SEQ ID NO.6) of CD8α signal peptide (leader): ATGGCACTGCCAGTGACAGCCCTGCTGCTGCCACTGGCCCTGCTGCTGCACGCAGCACGCCCT;

[0061] The amino acid sequence (SEQ ID NO.7) of CD8α hinge region (hinge): TTTPARPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACD;

[0062] The nucleotide sequence (SEQ ID NO.8) of C...

Embodiment 2

[0069] Example 2: Construction of an anti-BCMA chimeric antigen receptor expression vector

[0070] (1) Synthesize the G8 CAR sequence of the whole gene, double digest the G8 CAR and the empty vector synthesized by the whole gene with EcoRI and BamHI, digest it in a water bath at 37°C for 30 minutes, use 1.5% agarose gel for DNA electrophoresis, and then Use Tiangen's agarose gel kit for purification and recovery;

[0071] (2) Connection of pCDH-EF1-MCS vector and G8 CAR gene fragment:

[0072] The connection system is as follows:

[0073] components Amount added (μl) PCDH-EF1-MCS vector 2(50ng) G8 CAR gene 10(150ng) T4 DNA Ligation Buffer 2 T4 DNA Ligase (NEB) 1 dd H 2 o

5 total 20

[0074] After ligation at 22°C for 1 h, the ligation product was directly transformed into Stbl3 Escherichia coli competent cells, and 200 μl of the transformation product was coated with an ampicillin-resistant LB plate, and the LB plate...

Embodiment 3

[0076] Example 3: Lentiviral packaging

[0077] The lentiviral expression vectors in the examples were respectively packaged with lentiviruses, using a four-plasmid system, and the specific steps were as follows:

[0078] (1) The four-plasmid system respectively expresses gag / pol, Rev, VSV-G required for lentiviral vector packaging and the artificial chimeric antigen receptor composed of the engineered and stable single-chain antibody of the present invention: the four plasmids are transiently transfected into 293T Cells, with a total mass of 10 μg;

[0079] (2) Add the above-mentioned plasmid into a certain volume of serum-free DMEM, mix well and let it stand for 15 minutes, add the above-mentioned mixture into a T75 culture flask lined with 293T cells, mix gently, and incubate at 37°C , 5%CO 2 Cultivate in a cell incubator for 6 hours;

[0080] (3) Replace the fresh medium after 6 hours, continue the culture, and add 10 mM sodium butyrate solution, and collect the culture...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a chimeric antigen receptor targeting BCMA, which comprises an extracellular domain capable of binding to an antigen, a transmembrane domain and at least one intracellular domain, wherein the extracellular domain is an anti-BCMA single domain antibody; wherein the amino acid sequence of the anti-BCMA single domain antibody is selected from: (a) an amino acid sequence as shown in SEQ ID NO. 1; or (b) a variant which is formed by substitution, addition or deletion of one or more amino acids in the amino acid sequence shown in SEQ ID NO. 1 and which is capable of specifically binding to the chimeric antigen receptor and has a function of binding to BCMA and inducing T cell signaling conduction. The chimeric antigen receptor has smaller clinical side effects and highersafety, can effectively reduce solid tumor focus and effectively improve the treatment effect of tumors.

Description

technical field [0001] The present invention relates to the field of cellular immunotherapy of tumors, in particular to a chimeric antigen receptor targeting BCMA and its application, specifically the chimeric antigen receptor T (CAR-T) cell technology based on the specific target BCMA The construction method and its application in anti-tumor therapy. Background technique [0002] With the development of tumor immunology theory and clinical technology, chimeric antigen receptor T-cell immunotherapy (CAR-T) has become one of the most promising tumor immunotherapy. Generally, a chimeric antigen receptor CAR consists of a tumor-associated antigen-binding region, an extracellular hinge region, a transmembrane region, and an intracellular signal transduction region. Usually, CAR contains the single chain fragment variable region (Single chain fragment variable, scFv) of the antibody or the binding domain specific to the tumor associated antigen (tumor associated antigen, TAA), w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N5/10A61K35/17A61P35/00
CPCA61K35/17A61P35/00C07K14/7051C07K14/70517C07K14/70521C07K14/70578C07K16/2878C07K2317/569C07K2319/00C07K2319/02C07K2319/03C07K2319/33C07K2319/74C12N5/0636C12N15/86C12N2510/00C12N2740/15043C12N2800/107
Inventor 李光超罗敏曾剑华郭锦涛莫文俊
Owner GUANGZHOU BIO GENE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com