Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Sanfilippo B syndrome lentiviral vector, lentivirus and preparation method and application thereof

A technology of lentiviral vector and syndrome, which is applied in the field of preparing drugs for the treatment of Gaucher disease, can solve the problems that the clinical effect of disease treatment cannot meet expectations, affect the effect of disease treatment, and the difference in gene transfer efficiency, etc., and achieve strong stability, Good safety and the effect of improving safety performance

Inactive Publication Date: 2018-10-30
SHENZHEN GENO IMMUNE MEDICAL INST
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, although there are many gene therapy methods using viral vectors for gene delivery at home and abroad, the gene delivery efficiency caused by different viral vectors or even different preparation methods of the same vector is significantly different, and the gene delivery efficiency will directly affect the therapeutic effect of the disease
At present, most of the methods of applying cell therapy to treat genetic diseases are too inefficient and only modify blood stem cells, so that the clinical effect of disease treatment has always failed to meet expectations. Therefore, there is an urgent need to maximize the efficiency of viral gene delivery and Ways to Improve Outcomes for Genetic Diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sanfilippo B syndrome lentiviral vector, lentivirus and preparation method and application thereof
  • Sanfilippo B syndrome lentiviral vector, lentivirus and preparation method and application thereof
  • Sanfilippo B syndrome lentiviral vector, lentivirus and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] The construction of embodiment 1 lentiviral vector

[0068] This embodiment provides a method for constructing a lentiviral vector, which specifically includes the following steps:

[0069] (1) Schematic diagram of the transformation of the lentiviral vector pTYF as shown in figure 1 As shown, the specific mutation is to mutate the wild-type 5' splice donor site GT to CA, and delete the enhancer in U3. The specific transformation method can be found in "Contributions of Viral Splice Sites and cis-Regulatory Elements to Lentivirus Vector Function, YAN CUI, JOURNAL OF VIROLOGY, July 1999, p.6171–6176”, as follows:

[0070] Modification of the 5' splice donor site:

[0071] Wild type (SEQ ID NO.3): GGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

[0072] Mutant (SEQ ID NO.4): GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

[0073] (2) Insertion of promoter and NAGLU gene:

[0074] Synthesize the normal NAGLU gene sequence (as shown in SEQ ...

Embodiment 2

[0079] Preparation and identification of embodiment 2 lentivirus

[0080] 1) Preparation of lentivirus

[0081] The lentiviral vector prepared in Example 1 was further packaged, purified and concentrated to obtain the lentivirus. The specific process is as follows: image 3 As shown, the specific steps are as follows:

[0082] (1) The lentiviral vector constructed in Example 1 and the packaging helper plasmid pNHP and pHEF-VSV-G were co-transfected into mammalian cells HEK293T and cultured for 24-72h;

[0083] (2) Purifying and concentrating the cultured lentivirus to obtain the lentivirus.

[0084] 2) Identification of lentivirus

[0085] The collected neuron cells and glial cells after transfection with normal NAGLU gene lentivirus were identified for protein expression, so as to clarify the expression of NAGLU gene in neuron cells.

[0086] From the results, there is no expression of NAGLU protein in the negative control cells of neuron cells without lentivirus transfec...

Embodiment 3

[0088] The therapeutic effect of embodiment 3 lentivirus

[0089] The lentivirus carrying normal NAGLU prepared in Example 2 is directly injected into the brain to treat Sanfilippo B syndrome disease. The schematic diagram of the treatment process is as follows Figure 4 As shown, the injection site of the lentiviral vector and the specific coordinates of the brain are determined by MRI or CT of the brain, and the lentiviral vector carrying the normal NAGLU gene is directly injected into the brain of the patient for disease treatment. .

[0090] It can be seen from the results that after direct injection of lentivirus, the transfer efficiency and expression level of NAGLU gene in the brain can be effectively improved.

[0091] In summary, the lentiviral vector of this application can directly repair the damaged NAGLU gene in cells, and can effectively improve the transfer efficiency and expression level of NAGLU gene in the brain, which is of great significance to ensure the ef...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Gaucher lentiviral vector, a lentivirus and a preparation method and application thereof. The lentiviral vector is obtained by modifying a splicing donor site at the terminal5' of a pTYF lentiviral vector and further comprises NAGLU gene. The NAGLU gene is specifically connected in on the basis of the lentiviral vector after being modified, so that more efficient genetictransmission can be realized while safety is ensured, expression of the NAGLU gene in brain related cells is improved, and transmission of normal gene in the process of Sanfilippo B syndrome gene therapy can be completed more efficiently.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a Sanfilippo B syndrome lentiviral vector, a lentivirus and a preparation method and application thereof, in particular to an application of an improved lentiviral vector to optimize the expression of NAGLU gene for preparation and treatment of Gaucher disease medicine. Background technique [0002] Mucopolysaccharidosis (MPS) type III B, also known as Sanfilippo B syndrome, is a disease that causes progressive cognitive impairment. The disease is caused by the accumulation of only partially degraded heparan sulfate oligosaccharides. Mutations in the Sanfilippo B-associated gene NAGLU lead to loss of the catalytic activity of the alpha-mutated N-acetylglucosaminidase. The symptoms and pathological features of Sanfilippo B syndrome are similar to those of Sanfilippo-A, and the accumulation of heparan sulfate oligosaccharides not only affects tissues and organs, especial...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N7/01C12N5/10A61K48/00A61K38/17A61P3/00A61P25/28
CPCA61K38/1709A61K48/0025A61K48/005A61P3/00A61P25/28C12N5/0634C12N5/0665C12N15/86C12N2510/00C12N2740/15043A61K38/47A61K48/0008A61K48/0075C12N2740/16043C12Y302/0105
Inventor 王盈颖
Owner SHENZHEN GENO IMMUNE MEDICAL INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com