Supercharge Your Innovation With Domain-Expert AI Agents!

C2H2-type transcription factor gene and application thereof

A transcription factor and gene technology, applied in the field of genetic engineering, can solve the problems of incomplete recognition and binding of target genes, and achieve the effects of low technical cost, small environmental impact, and easy operation

Active Publication Date: 2018-06-15
KUNMING UNIV OF SCI & TECH
View PDF19 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The way that C2H2 zinc finger proteins participate in the regulation of gene expression is to recognize and bind to specific DNA fragments, but how to recognize and bind to target genes is not completely clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • C2H2-type transcription factor gene and application thereof
  • C2H2-type transcription factor gene and application thereof
  • C2H2-type transcription factor gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Cryptococcus terrestris ( C . humicolus ) Extraction of total RNA from strain BSLL1-1 and synthesis of cDNA

[0024] Use TRIzoL kit (TaKaRa company) to extract total yeast RNA. The steps are as follows: Take about 0.2 g of Cryptococcus terrestris, add it to a mortar and grind it with liquid nitrogen to a powder, then add 1 mL of TRIzoL extract Continue to grind until clear. Transfer the grinding solution to an EP tube, let stand at room temperature for about 5 minutes, add 0.2 mL of chloroform and shake vigorously for 1 minute, then place the sample on ice for 5 minutes, centrifuge at 12000 rpm 4°C for 15 minutes; transfer the supernatant to a new EP In the tube, another extraction was performed with chloroform. Take the supernatant and add an equal volume of isopropanol. After standing at -20°C for 0.5 h, centrifuge at 12000 rpm, 4°C for 30 min; discard the supernatant, wash twice with 1 mL of 75% ethanol, 12000 rpm, 4°C for 5 min, pour out the ethanol. Aft...

Embodiment 2

[0034] Example 2: Fluorescence quantitative PCR analysis asr1 Gene expression under aluminum stress

[0035] Design real-time PCR primers for the 18S rRNA and C2H2 type transcription factor Asr1 encoding genes of Cryptococcus terrestris. The 18S rRNA gene is used as an internal reference. The primer sequences are as follows:

[0036]

[0037] Use SYBR Premix Ex TaqII (Tli RNaseH Plus) kit for real-time PCR, the reaction system is 20 µL (see the table below), and the Applied Biosystems 7500 Fast Real-Time PCR System uses a two-step PCR reaction program: Stage 1: pre-denaturation, Reps : 1,95 ℃ 30 s; Stage 2: PCR reaction, Reps: 40, 95 ℃ 5s, 60 ℃ 30 s; after the reaction, confirm the amplification curve and melting curve of real-time PCR, and make standard curve when performing PCR quantification Wait.

[0038]

[0039] With 18S rRNA gene as the internal control, the gene expression of the concentration gradient experimental group without aluminum ion culture for 48 h was used as t...

Embodiment 3

[0042] Example 3: Asr1 transcription factor asr1 Gene cloning and sequencing

[0043] Using Cryptococcus terrestris cDNA as a template asr1 PCR amplification of genes, the amplified primers are forward: AAGCTT ATGCCGCCTGGACCGTCACCCAAAGAT (underlined Hind Ⅲ restriction site), reverse: GGATCC CTAGAATGGGCATGGCCCACATTCGTT (underlined BamH Ⅰ restriction site). Reaction conditions: first pre-denaturation at 94 ℃ for 3 min, then 30 cycles of 94 ℃, 30 S, 62 ℃, 30 S, 72 ℃, 2 min, and extension at 72 ℃ for 10 min after the end of the cycle. The obtained PCR amplification products were subjected to agarose gel electrophoresis ( figure 2 ), use DNA gel recovery kit to purify the target band. Connect the target fragment to the pMD18-T vector to obtain a recombinant vector pMD18-T- containing the target fragment asr1 . It was transformed into E. coli competent cells DH5α by heat stimulation, and then spread on the LB solid plate containing ampicillin, and inverted at 37 ℃ for about 12...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a C2H2-type transcription factor gene asr1. The C2H2-type transcription factor gene asr1 is cloned in a Cryptococcus humicolus BSLL1-1 strain, has a nucleotide sequence shown in the formula of SEQ ID NO: 1 and codes a protein with an amino acid sequence shown in the formula of SEQ ID NO: 2. An asr1 recombinant fragment blocked by a hygromycin gene is introduced into Cryptococcus humicolus, the Cryptococcus humicolus produces mutation, and the mutant strain increases resistance to various ionic stresses and has the application potential to reduce various ions in soil.

Description

Technical field [0001] The present invention belongs to the field of genetic engineering. Specifically, it relates to the nucleotide sequence and amino acid sequence of the C2H2 type transcription factor gene encoded by Cryptococcus terrestris, and relates to a homologous recombination plasmid containing the gene and a mutant strain containing the homologous recombination fragment. Their preparation methods and their application in resisting ion stress in the environment. Background technique [0002] Under adversity, plant cells often rely on the accumulation of inorganic ions to reduce the intracellular osmotic potential. According to different plant species, the types of ions accumulated and absorbed in plants are also different, mainly K + , Na + , Ca 2+ , Mg 2+ Wait. Too many ions will cause stress, and ionic stress will cause nutrient loss, respiratory obstruction, osmotic stress, and growth slowdown. The effect of ion stress on the overall development of plants is manifes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N1/19C12R1/645
CPCC07K14/39
Inventor 年洪娟李定华文增叶刘帅代梦瑶
Owner KUNMING UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More