Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lentiviral expression vector for inducing hpv16 E6/E7 gene expression under hypoxic conditions

A technology of HPV16E6 and expression vectors, which is applied in the field of hypoxia-induced expression of lentiviral expression vectors, can solve problems such as leakage, and achieve the effects of improving efficiency, avoiding immunogenic reactions, and improving survival adaptability

Active Publication Date: 2021-04-02
长春力太生物技术有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantages of tetracycline induction are: the induction system itself requires long-term use of tetracycline to be toxic to cells, even in the absence of tetracycline induction, there will still be leaky expression of E6 / E7, and the fusion protein tetracycline transcription activator and Hepers Simplex as transcription activators The active factor VP16 of Virus itself can cause immunogenic response as a foreign protein in host cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lentiviral expression vector for inducing hpv16 E6/E7 gene expression under hypoxic conditions
  • Lentiviral expression vector for inducing hpv16 E6/E7 gene expression under hypoxic conditions
  • Lentiviral expression vector for inducing hpv16 E6/E7 gene expression under hypoxic conditions

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Hypoxia induces CD34 + Differentiation of hematopoietic progenitors into immortalized erythroid progenitors

[0036] 1. Construction of pFUGW-HRE-E6 / E7 vector

[0037] Nine copies of the hypoxia response element Epo HRE sequence (CCGGGTAGCTGGCGTACGTGCTGCAG) were coupled to the CMV minimal promoter and linked to the HPV16 E6 / E7 and SV40 polyadenylation signals (polyA). Then the expression cassette containing 9 copies of the HRE sequence (H9), CMV minimal promoter, HPV16 E6 / E7 and SV40 polyadenylation signal (polyA) was cloned into the 2597-4160 site of the lentiviral vector pFUGW (Addgene) During this period, the pFUGW-H9-E6 / E7 vector was generated, and the construction map is shown in figure 1 . figure 1 Middle, HRE: hypoxia response element, CMVminPro: cytomegalovirus minimal promoter, human papillomavirus E6 / E7 gene, Ubc is Ubiqutin promoter; EGFP is green fluorescent gene, WPRE is woodchuck hepatitis virus post-transcriptional regulatory element . fig...

Embodiment 2

[0045] Example 2. Immortalization and differentiation of erythroid progenitor cells into mature erythrocytes

[0046] Immortalized erythroid progenitor cells induced under hypoxic conditions stopped hypoxic culture after 100 days of culture and were transferred to erythroid terminal differentiation culture conditions for culture. The speed of obtaining terminal red blood cells is basically close to the speed of direct differentiation of stem cells into red blood cells. Specific steps are as follows:

[0047] Transfer the immortalized erythroid progenitor cells to basal medium at 37°C in 94% N 2 , 5% CO 2 and 1%O 2 cultured under hypoxic conditions for 8 days. The basal medium was changed to differentiation medium (basal medium supplemented with 500 ug / ml heparin but without SCF and IL-3). And under normal oxygen supply conditions (95% air and 5% CO 2 ). On day 6, the cell concentration was maintained at 1-2 × 10 5 / ml, add fresh medium to maintain the cell concentratio...

Embodiment 3

[0053] Example 3. Functional evaluation of induced erythrocytes

[0054] Use Hemox Analyzer (TCS Scientific Corp) to measure the oxygen binding capacity of the erythrocytes induced by the present invention, fully oxidize the cultured blood cells in the air, then completely deoxygenate in the nitrogen box, and use the Clark oxygen electrode probe to measure the oxygen tension in aerobic and anaerobic conditions. The degree of change between oxygen, while recording the wavelength value of oxyhemoglobin in dual-wavelength spectrophotometry. Human peripheral whole blood was used as a control. The degree of deformation was measured using ARCR (Automated Rheoscope and cellanalyzer).

[0055] Immortalized cells terminate immortalization under aerobic conditions, and differentiate into mature anucleated red blood cells-reticulocytes under terminal red blood cell differentiation conditions, which account for about 42% of the total cells. These cells contain 86-88% adult hemoglobin an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lentiviral expression vector for inducing HPV16 E6 / E7 gene expression under hypoxia conditions. The lentiviral expression vector contains a hypoxia response element, a CMV-minimum promoter and a HPV16 E6 / E7 gene. The lentiviral expression vector can induce directional differentiation of hematopoietic stem cells into immortalized erythroid progenitor cells under the hypoxia conditions and the immortalized erythroid progenitor cells can differentiate into mature erythrocytes under normal oxygen supplying conditions. The erythrocytes induced by the vector has deformability and a oxygen bonding and release capability similar to those of the normal mature erythrocytes and has oxygen content of hemoglobin of 28+ / -2mmHg. The diameter of the erythrocyte injected into a mouse for 10min to 24h is decreased and the erythrocyte has a mature erythrocyte form in 24h and has good adaptability of existence in the body.

Description

technical field [0001] The invention discloses a hypoxia-induced expression lentiviral expression vector, which belongs to the technical field of molecular biology. Background technique [0002] Blood is an important substance that exists in human blood vessels and various tissues. It has the physiological functions of transporting, regulating human body temperature, defense, regulating human osmotic pressure and acid-base balance. The main function of red blood cells is to transport oxygen and carbon dioxide. The main function of white blood cells is to kill bacteria, resist inflammation, and participate in the immune process in the body. Platelets mainly play a hemostatic function in the body. Osmotic pressure, involved in immunity, coagulation and anticoagulant function. Among them, the function of red blood cells to transport oxygen is particularly important, and it is a key factor in maintaining basic life activities. Once the human body loses too much blood, or the h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867C12N5/10C12N5/078
Inventor 宋海鹏叶海波王庆东
Owner 长春力太生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com