Low temperature xylosidase HJ14GH43 and salt-tolerant mutant thereof
A technology of xylosidase and mutants, which is applied in the field of genetic engineering and protein transformation, and can solve the problems of no reports
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: Cloning of xylosidase gene hJ14GH43
[0043] Extraction of Bacillus genomic DNA: Centrifuge the bacterial liquid cultured in liquid for 2 days to take the bacterial cells, add 1mL lysozyme, treat at 37°C for 60min, then add the lysate, the composition of the lyse is: 50mM Tris, 20mM EDTA, 500mM NaCl, 2%( w / v) SDS, pH 8.0, lysed in a water bath at 70°C for 60 minutes, mixed every 10 minutes, and centrifuged at 10,000 rpm for 5 minutes at 4°C. The supernatant was extracted in phenol / chloroform to remove impurity proteins, and then an equal volume of isopropanol was added to the supernatant. After standing at room temperature for 5 minutes, centrifuge at 10,000 rpm for 10 minutes at 4°C. The supernatant was discarded, the precipitate was washed twice with 70% ethanol, dried in vacuum, dissolved by adding an appropriate amount of TE, and stored at -20°C for later use.
[0044] 5 μg of the Bacillus genome was broken into 400–600 bp fragments with an ultrasonic br...
Embodiment 2
[0046] Embodiment 2: Preparation of recombinant xylosidase HJ14GH43
[0047] Using 5'ATGAAGATTACCAATCCAGTGCT 3' and 5'TTATTCGTCTGTTCCTCATAGC 3' as a primer pair and Bacillus genomic DNA as a template, PCR amplification was performed. The PCR reaction parameters were: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 sec, annealing at 52°C for 30 sec, extension at 72°C for 1 min and 30 sec, and after 30 cycles, incubation at 72°C for 10 min. As a result of PCR, the xylosidase gene hJ14GH43 was obtained, and a protruding A base was introduced at the 3' end of the gene. The xylosidase gene hJ14GH43 and the expression vector pEasy-E1 were connected by T-A method to obtain the recombinant expression plasmid pEasy-E1-hJ14GH43 containing hJ14GH43. Transform pEasy-E1-hJ14GH43 into Escherichia coli BL21(DE3) to obtain recombinant Escherichia coli strain BL21(DE3) / hJ14GH43.
[0048] Take the recombinant Escherichia coli strain BL21(DE3) / hJ14GH43 containing the recombina...
Embodiment 3
[0049] Example 3: Site-directed mutation of xylosidase HJ14GH43 and preparation method of mutant V322D
[0050] Through the analysis of the advanced structure of xylosidase HJ14GH43, it was found that the amino acid V322 is located in a random coil, and the 322-position amino acid is mutated from valine to aspartic acid, which may increase the hydrophilic ability of the enzyme, thereby making the enzyme Enhanced salt tolerance.
[0051] Using the expression plasmid pEasy-E1-hJ14GH43 as a template, the Fast Mutagenesis System of Beijing Quanshijin Biotechnology Co., Ltd. was used to perform point mutations, and the 965th nucleotide T of hJ14GH43 was mutated to A, and the mutation of pEasy-E1-hJ14GH43 was obtained Recombinant plasmid pEasy-E1-v322d. The mutation primer is 5'AGATCGAAGAAAAGG A TTTTGCACCAAC 3' and 5' T CCTTTTCTTCGATCTTTGGCGCTTC 3' (the mutation point is underlined). The parameters of the PCR reaction were: denaturation at 94°C for 5 min; then denaturation at 94...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com