Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Low temperature xylosidase HJ14GH43 and salt-tolerant mutant thereof

A technology of xylosidase and mutants, which is applied in the field of genetic engineering and protein transformation, and can solve the problems of no reports

Active Publication Date: 2016-09-21
YUNNAN NORMAL UNIV
View PDF1 Cites 25 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, low-temperature endoxylanase and salt-tolerant endoxylanase have been reported, but low-temperature xylosidase and salt-tolerant xylosidase have not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Low temperature xylosidase HJ14GH43 and salt-tolerant mutant thereof
  • Low temperature xylosidase HJ14GH43 and salt-tolerant mutant thereof
  • Low temperature xylosidase HJ14GH43 and salt-tolerant mutant thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Cloning of xylosidase gene hJ14GH43

[0043] Extraction of Bacillus genomic DNA: Centrifuge the bacterial liquid cultured in liquid for 2 days to take the bacterial cells, add 1mL lysozyme, treat at 37°C for 60min, then add the lysate, the composition of the lyse is: 50mM Tris, 20mM EDTA, 500mM NaCl, 2%( w / v) SDS, pH 8.0, lysed in a water bath at 70°C for 60 minutes, mixed every 10 minutes, and centrifuged at 10,000 rpm for 5 minutes at 4°C. The supernatant was extracted in phenol / chloroform to remove impurity proteins, and then an equal volume of isopropanol was added to the supernatant. After standing at room temperature for 5 minutes, centrifuge at 10,000 rpm for 10 minutes at 4°C. The supernatant was discarded, the precipitate was washed twice with 70% ethanol, dried in vacuum, dissolved by adding an appropriate amount of TE, and stored at -20°C for later use.

[0044] 5 μg of the Bacillus genome was broken into 400–600 bp fragments with an ultrasonic br...

Embodiment 2

[0046] Embodiment 2: Preparation of recombinant xylosidase HJ14GH43

[0047] Using 5'ATGAAGATTACCAATCCAGTGCT 3' and 5'TTATTCGTCTGTTCCTCATAGC 3' as a primer pair and Bacillus genomic DNA as a template, PCR amplification was performed. The PCR reaction parameters were: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 sec, annealing at 52°C for 30 sec, extension at 72°C for 1 min and 30 sec, and after 30 cycles, incubation at 72°C for 10 min. As a result of PCR, the xylosidase gene hJ14GH43 was obtained, and a protruding A base was introduced at the 3' end of the gene. The xylosidase gene hJ14GH43 and the expression vector pEasy-E1 were connected by T-A method to obtain the recombinant expression plasmid pEasy-E1-hJ14GH43 containing hJ14GH43. Transform pEasy-E1-hJ14GH43 into Escherichia coli BL21(DE3) to obtain recombinant Escherichia coli strain BL21(DE3) / hJ14GH43.

[0048] Take the recombinant Escherichia coli strain BL21(DE3) / hJ14GH43 containing the recombina...

Embodiment 3

[0049] Example 3: Site-directed mutation of xylosidase HJ14GH43 and preparation method of mutant V322D

[0050] Through the analysis of the advanced structure of xylosidase HJ14GH43, it was found that the amino acid V322 is located in a random coil, and the 322-position amino acid is mutated from valine to aspartic acid, which may increase the hydrophilic ability of the enzyme, thereby making the enzyme Enhanced salt tolerance.

[0051] Using the expression plasmid pEasy-E1-hJ14GH43 as a template, the Fast Mutagenesis System of Beijing Quanshijin Biotechnology Co., Ltd. was used to perform point mutations, and the 965th nucleotide T of hJ14GH43 was mutated to A, and the mutation of pEasy-E1-hJ14GH43 was obtained Recombinant plasmid pEasy-E1-v322d. The mutation primer is 5'AGATCGAAGAAAAGG A TTTTGCACCAAC 3' and 5' T CCTTTTCTTCGATCTTTGGCGCTTC 3' (the mutation point is underlined). The parameters of the PCR reaction were: denaturation at 94°C for 5 min; then denaturation at 94...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses low temperature xylosidase HJ14GH43 and a salt-tolerant mutant thereof. The amino acid sequence of the xylosidase is as shown in SEQ ID No.1, and the nucleotide sequence of a xylosidase gene hJ14GH43 for coding xylosidase HJ14GH43 is as shown in SEQ ID No.2; the amino acid sequence of the salt-tolerant mutant is as shown in SEQ ID No.3. The optimum pH of xylosidase HJ14GH43 is 7.0, and the optimum temperature is 25 DEG C. According to the low temperature xylosidase HJ14GH43 and the salt-tolerant mutant thereof, site-directed mutation is conducted on the basis of xylosidase HJ14GH43, valine at the 322 locus is mutated to be aspartic acid, the mutant V322D is obtained, and the activity and stability of the mutant V322D in NaCl are both improved. The HJ14GH43 and the salt-tolerant mutant thereof can be applied to food industries and aquatic feed.

Description

technical field [0001] The invention discloses a low-temperature xylosidase and a salt-tolerant mutant thereof, belonging to the technical field of genetic engineering and protein transformation. Background technique [0002] Xylan is the most abundant polysaccharide in hemicellulose, and the complete hydrolysis of xylan requires the synergy of multiple enzymes, including endo-1,4-β-D-xylanase (EC3. 2.1.8) and xylosidase (β-D-xylosidase, EC 3.2.1.37) etc. (Collins et al. FEMS Microbiol Rev, 2005, 29:3–23.). Endoxylanase can randomly cut the backbone of xylan to generate xylooligosaccharides, and xylosidase can hydrolyze xylooligosaccharides into xylose (Collins et al.FEMS Microbiol Rev, 2005, 29 :3–23.). Xylanase has application value in the fields of feed, food, wine making, textile and paper making (Collins et al. FEMS Microbiol Rev, 2005, 29:3-23.). [0003] Salt-tolerant enzymes still have catalytic activity and stability under high-concentration NaCl, and can be used...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/24C12N15/56C12N15/70C12N1/21
Inventor 周峻沛黄遵锡张蕊刘钰唐湘华李俊俊吴倩慕跃林
Owner YUNNAN NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com