Jellyfish toxin polypeptide, preparation and application
A jellyfish toxin, jellyfish technology, applied in the fields of biochemistry and molecular biology, can solve the problem of no research reports, and achieve the effect of non-addiction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] Polypeptides are synthesized by chemical synthesis: the polypeptides are synthesized by Fmoc chemical method. The synthesis reaction is carried out from the C-terminal to the N-terminal, and there are free amino groups on the Rink medium (available from Advanced ChemTech Company), and the amino acids are connected in the order from the C-terminal to the N-terminal. During each ligation step, the amino acid residues are activated, and the activation mixture contains 4 times as many HBTU, HOBt, DIEA and Fmoc-amino acids as there are free amino groups on the medium. After each amino acid attachment reaction, a pyridine / acetic acid / N-methylimidazole mixture was used to block the unattached free amino groups. After each amino acid linking reaction and before the next amino acid linking, the Fmoc-group on the medium should be removed, and the Fmoc-group should be removed using dimethylformamide containing 20% piperidine. Finally, after all amino acid residues are linked se...
Embodiment 2
[0018] The jellyfish is used as a raw material, and the nucleotide capable of encoding the jellyfish toxin polypeptide is expressed by a gene recombination method to obtain the polypeptide. Extract DNA from jellyfish as a template for polymerase chain reaction; add primers, the primer sequence is: the upstream sequence is 5`-CTTAGGAGCTGTCGCTTCATT-3`, the downstream sequence is 5`-AAACCATCCTGTGCGAAAAG-3`, after denaturation and extension , renaturation, the DNA chain is replicated in vitro, and the DNA chain contains a polynucleotide capable of encoding the polypeptide, the sequence is:
[0019] TATGGAGTTGGCTTAGGAGCTGTCGCTTCATTGTTATCGTCTGTAATAGGGCTTTTCGCACAGGATGGTTTTAAGAAC; cut off the polynucleotide encoding the jellyfish toxin polypeptide with endonuclease, and purify; use ligase to connect the polynucleotide and pBR322 vector to make a plasmid; transform the prepared plasmid into competent Escherichia coli ; identify and screen the Escherichia coli transformed into the plasm...
Embodiment 3
[0021] Using square jellyfish as a raw material, the method of gene recombination is used to express the nucleotide capable of encoding jellyfish toxin polypeptide to obtain the polypeptide. Extract DNA from the jellyfish as a template for polymerase chain reaction; add primers, the primer sequence is: the upstream sequence is 5`-CTTAGGAGCTGTCGCTTCATT-3`, the downstream sequence is 5`-AAACCATCCTGTGCGAAAAG-3`, after denaturation and extension , renaturation, the DNA chain is replicated in vitro, and the DNA chain contains a polynucleotide capable of encoding the polypeptide, the sequence is:
[0022] TATGGAGTTGGCTTAGGAGCTGTCGCTTCATTGTTATCGTCTGTAATAGGGCTTTTCGCACAGGATGGTTTTAAGAAC; cut off the polynucleotide encoding jellyfish toxin polypeptide with endonuclease, and purify; use ligase to connect the polynucleotide and pUC18 vector to make a plasmid; transform the prepared plasmid into competent Escherichia coli ; identify and screen the Escherichia coli transformed into the plasm...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com