Engineering bacteria for knocking out pyruvate formate-lyase genes and application of engineering bacteria
A technology of pyruvate formic acid and engineering bacteria, applied in the biological field, can solve the problems of reduced 1,3-propanediol production, waste of substrate glycerol, inhibition of cell growth, etc., and achieve the effects of reduced toxicity, reduced formic acid production, and increased rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1: Construction of a Klebsiella pneumoniae mutant strain in which the key gene of the formate metabolic pathway—pyruvate formate lyase flpB gene is inactivated.
[0023] (l), cloning the partial sequence of pyruvate formate lyase gene pflB
[0024] Design primers for PCR amplification of part of the gene sequence of pyruvate formate lyase flpB. The primer sequences are as follows: upstream primer pflB-F: taggtacctgaaagacaaattcgcccag and downstream primer pflB-R: gagagctccatgcgatccattacttcgt. Using the genomic DNA of wild-type Klebsiella pneumoniae (preserved in the China Center for Type Culture Collection, preservation number: CCTCC M 2011075) as a template, under the guidance of primers pflB-F and pflB-R, pyruvate was amplified by PCR For the partial sequence of formate lyase pflB, PCR amplification conditions are: first 95°C for 3 minutes; then 94°C for 1 minute, 50°C for 1 minute, 72°C for 1 minute, a total of 32 cycles; finally 72°C for 10 minutes. After th...
Embodiment 2
[0029] Example 2: Detection of activity of pyruvate formate lyase flpB gene in an insertionally inactivated Klebsiella pneumoniae mutant strain.
[0030] Carry out the activity detection of pyruvate formate lyase to the Klebsiella pneumoniae mutant strain whose flpB gene of pyruvate formate lyase flpB gene of embodiment 1 is inserted inactivated, with wild-type Klebsiella pneumoniae as a control, the specific method comprises The following steps:
[0031] (1) The Klebsiella pneumoniae mutant strain whose pyruvate formate lyase flpB gene is inactivated is inoculated in 100 mL of medium (every liter of water contains 20 g of glycerol, 10 g of tryptone, 5 g of yeast powder, 5 g of NaCl, pH 7.0, Sterilize at 120°C for 20 minutes), shake and culture at 37°C for 6-12 hours, and collect bacteria by sampling and centrifuging every 2 hours;
[0032] (2) Suspend and wash the bacteria twice with 100mL phosphate buffer (0.1M, pH7.5);
[0033] (3) Suspend the bacteria with 2.5mL phosphat...
Embodiment 3
[0037] Example 3: Fermentative production of 1,3-propanediol by Klebsiella pneumoniae mutant strain with knockout pyruvate formate lyase flpB gene
[0038] (1) culture medium
[0039] LB medium (g·L -1 ): yeast powder 5, peptone 10, NaCl 10, agar 10, adjusted to pH 7.0, for short-term preservation and activation of Klebsiella species. The composition of seeds and fermentation medium is shown in Table 1:
[0040] Table 1: Medium Composition
[0041]
[0042]
[0043] (2) Training method
[0044] (i) Seed activation: Klebsiella pneumoniae mutant strains and wild bacteria with knockout of the pyruvate formate lyase flpB gene preserved in glycerol tubes in Example 1 were respectively inoculated into LB medium for slant activation, at a temperature of 37° C. Incubate for 12 hours to activate the seeds.
[0045] (ii) Seed culture: 250mL triangular flask sealed with 9 layers of gauze, filled with 100mL of seed culture medium, inserted into the slant lawn (activated seeds o...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com