An engineering bacterium for knocking out pyruvate formate lyase gene and its application
A pyruvate formic acid and lyase technology, applied in the biological field, can solve the problems of substrate glycerol waste, inhibition of cell growth, and reduced production of 1,3-propanediol, and achieve the effects of reduced formic acid production, reduced toxic effects, and improved levels
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1: Construction of a Klebsiella pneumoniae mutant strain in which the key gene of formic acid metabolism pathway-pyruvate formate lyase flpB gene is inactivated.
[0023] (l) Clone the partial sequence of pyruvate formate lyase gene pflB
[0024] Design primers for PCR amplification of part of the pyruvate formate lyase flpB gene sequence. The primer sequences are as follows: upstream primer pflB-F: taggtacctgaaagacaaattcgcccag and downstream primer pflB-R: gagagctccatgcgatccattacttcgt. Using wild-type Klebsiella pneumoniae (deposited in the Chinese Type Culture Collection, deposit number: CCTCCM2011075) genomic DNA as a template, under the guidance of primers pflB-F and pflB-R, PCR amplification pyruvate formic acid cleavage For the partial sequence of the enzyme pflB, the PCR amplification conditions are: first 95℃ for 3 min; then 94℃ for 1 min, 50℃ for 1 min, 72℃ for 1 min, a total of 32 cycles; finally 72℃ for 10 min. After the reaction, the PCR amplified produc...
Embodiment 2
[0029] Example 2: Detection of the activity of Klebsiella pneumoniae mutant strains in which the pyruvate formate lyase flpB gene was inserted and inactivated.
[0030] The Klebsiella pneumoniae mutant strain in which the pyruvate formate lyase flpB gene of Example 1 was inserted and inactivated was tested for the activity of pyruvate formate lyase. The wild-type Klebsiella pneumoniae was used as a control, and the specific methods included The following steps:
[0031] (l) Inoculate the Klebsiella pneumoniae mutant strain with inactivated pyruvate formate lyase flpB gene in 100 mL of medium (each liter of water contains 20 g of glycerol, 10 g of tryptone, 5 g of yeast powder, 5 g of NaCl, pH 7.0, Sterilize at 120°C for 20 minutes), culture with shaking at 37°C for 6-12 hours, and collect samples by centrifugation every 2 hours;
[0032] (2) Suspend and wash the bacteria twice with 100 mL phosphate buffer (0.1M, pH7.5);
[0033] (3) Use 2.5mL phosphate buffer (0.1M, pH7.5) to suspend...
Embodiment 3
[0037] Example 3: Fermentation of 1,3-propanediol by Klebsiella pneumoniae mutant strain knocked out of pyruvate formate lyase flpB gene
[0038] (1) Medium
[0039] LB medium (g·L -1 ): Yeast powder 5, peptone 10, NaCl10, agar 10, adjusted to pH 7.0, used for short-term preservation and activation of Klebsiella strains. See Table 1 for the composition of seeds and fermentation medium:
[0040] Table 1: Medium composition
[0041]
[0042]
[0043] (2) Training method
[0044] (i) Seed activation: Klebsiella pneumoniae mutant strains and wild bacteria that knocked out the pyruvate formate lyase flpB gene in Example 1 stored in glycerol tubes were respectively inoculated to the LB medium slope for activation, and the temperature was 37°C Cultivate for 12 hours to activate the seeds.
[0045] (ii) Seed culture: a 250mL Erlenmeyer flask is sealed with 9 layers of gauze, 100mL seed culture medium filled with liquid, connected to the slant moss (activated seed in step i), and aerobic seed c...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com