Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting salmonella invA gene based on rolling circle amplification and gold nanoparticles

A technology of rolling circle amplification and gene detection, which is applied in the detection field of Salmonella gene, can solve the problems of high cost of nanoparticles and fluorescent probes, and achieve the effects of low detection cost, improved sensitivity and high sensitivity

Inactive Publication Date: 2014-03-05
CHONGQING MEDICAL UNIVERSITY
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are two general methods. One is to use gold or silver nanoparticles to modify nucleic acid probes to detect target nucleic acid molecules according to the color change of the solution. The advantage is that the detection method is simple, but the cost of the nanoparticles used is relatively high. The other is to modify the nucleic acid molecules on the surface of the particles and add fluorescent probes to detect target molecules after different nucleic acid amplification methods. The advantage is that the detection sensitivity is high, but the cost of fluorescent probes is also high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting salmonella invA gene based on rolling circle amplification and gold nanoparticles
  • Method for detecting salmonella invA gene based on rolling circle amplification and gold nanoparticles
  • Method for detecting salmonella invA gene based on rolling circle amplification and gold nanoparticles

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1. Preparation of circularized DNA

[0032] Mix 100nmol 5' end phosphorylated template DNA to be circularized with 100nmol probe 2 in 100μL ligation buffer (pH7.5, 50mM Tris, 10mM MgCl 2 , 10mM dithiothreitol, 0.5mM ATP), then add 0.2U of T4DNA ligase, ligation reaction at 37°C for 60 minutes; inactivate T4DNA ligase at 65°C for 10 minutes, and the circularized template DNA obtained at -20°C Save it for future use. The 5' end phosphorylated template DNA sequence to be circularized is: 5'-p-CTCAGCTGTGTA ACAACATGAAGATTGTAGGTCAGAACTCACCTGTTAGAAACTGTGAAGAT CGCTTATTA TGTCCTATC-3', and the sequence of probe 2 is: 5'-AATACTCATCTGTTTACCG GGCATAAAAAAAAAACACAGCTGAGGATAGGACAT-3'.

Embodiment 2

[0033] Embodiment 2, preparation of gold nanoparticles and gold nanoprobes

[0034] (1) Soak all utensils in aqua regia for 24 hours, rinse them with double distilled water and set aside.

[0035] (2) Prepare 100mL of 0.01% HAuCl 4 4H 2 O deionized aqueous solution, placed on a heating magnetic stirrer and stirred, after the solution boiled, quickly added 4mL of 1% trisodium citrate solution. The color of the gold nanoparticle solution turns black at first, and then gradually turns into wine red. After continuing to stir for 8-10 minutes, turn off the heat source and continue stirring to cool to room temperature, and put it in a 4°C refrigerator for later use.

[0036] (3) Add 9 μL of 100 μM thiol-labeled signal probe to 300 μL of the gold nanoparticle solution in step 2 above, and stir overnight at 4°C for 12 hours on a magnetic stirrer. The signal probe sequence is: 5'-SH-(CH 2 ) 6 -TTTTTTCAGAACTCACCTGTTAGTTTTTT-biotin-3'.

[0037] (4) Add 0.5M NaCl to the gold nanopa...

Embodiment 3

[0039] Embodiment three, prepare the sample to be tested

[0040] 1. Extraction of genomic DNA used as PCR template

[0041] Because many Salmonella infections are foodborne, food or feces can usually be used as a source of detection.

[0042] Food testing: operate under sterile conditions, put the food to be tested into a homogenizer and stir into a homogenate, take 25g (or mL) of the homogenate of the sample to be tested and dilute it with 225mL buffered peptone water (BP) to 1 : 10 homogeneous slurry. Take 1 mL of the homogeneous liquid in a centrifuge tube, centrifuge at 12,000 r / min for 5 min, wash with sterilized saline twice, and finally suspend with 0.25 mL of distilled water, incubate in a 100°C water bath for 15 minutes, and then immediately place on ice. After centrifuging at 12000 r / min at 4°C for 10 minutes, the supernatant was transferred to a new tube, and the supernatant contained genomic DNA that could be directly used as a PCR template.

[0043] Stool dete...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for detecting salmonella invA gene based on rolling circle amplification and gold nanoparticles. The method comprises the following steps: dropwise adding a capture probe on a clean gold electrode, placing the gold electrode in a refrigerator overnight, taking out and sealing the gold electrode, dropwise adding a sample to be detected on the gold electrode, dropwise adding cyclic DNA after the reaction, reacting, carrying out rolling circle amplification, adding a gold nanoparticle probe, hybridizing and detecting a DPV signal. According to the method disclosed by the invention, the highly conserved invA gene of the salmonella is selected, the probe specifically combined with the invA gene is designed, and the salmonella invA gene is detected by an electrochemical technology in combination with rolling circle amplification and gold nanoparticle technology, so that the sensitivity is greatly perfected, the linear detection range is extended to 100 aM to 10 pM, and the sensitivity is 100 aM. The salmonella detection range in polluted milk is 20 to 6*10<8> CFU ml<-1>, and the lowest detectable limit is 20 CFU ml<-1>. A method for quickly and ultra-sensitively detecting salmonella is created in the invention to greatly improve the detection sensitivity, and the method has the advantages of being miniaturized in detection equipment, convenient, rapid and low in detection cost.

Description

technical field [0001] The invention relates to a detection method of Salmonella gene, in particular to a method for detection of Salmonella invA gene based on rolling circle amplification and gold nanometer, and belongs to the field of biological detection. Background technique [0002] Salmonella genus Enterobacteriaceae is a Gram-negative enterobacteriaceae, and it is one of the most important pathogenic bacteria in foodborne diseases. Salmonella infection mainly causes food poisoning, gastroenteritis, typhoid fever and paratyphoid fever. Studies have shown that the invasion protein of Salmonella is closely related to its pathogenicity, which determines the ability of bacteria to enter the host epithelial cells. It is mainly encoded by a series of genes, among which invA is the gene encoding the surface protein of Salmonella infecting epithelial cells, which is closely related to the pathogenicity of the bacteria and is unique to Salmonella. [0003] Currently, there ar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12R1/42
CPCC12Q1/6844C12Q2531/125C12Q2563/155C12Q2565/607
Inventor 丁世家周钦李剑波程伟颜玉蓉朱丹申波雷品华张伟李佳迅董芳
Owner CHONGQING MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com