Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Tea tree cytoplasm-type glutamine synthetase (GS) gene and encoding protein thereof

A technology of glutamine and synthetase, applied in the field of genetic engineering, can solve the problems such as there is no GS gene clone report of tea tree yet

Inactive Publication Date: 2012-01-11
ANHUI NORMAL UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report on the complete GS gene cloning of tea tree (Longjing 43)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tea tree cytoplasm-type glutamine synthetase (GS) gene and encoding protein thereof
  • Tea tree cytoplasm-type glutamine synthetase (GS) gene and encoding protein thereof
  • Tea tree cytoplasm-type glutamine synthetase (GS) gene and encoding protein thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Extraction of tea total RNA and acquisition of cDNA.

[0035] The total RNA of tea tree (Longjing 43) was extracted by plant total RNA purification kit (MACHEREY NAGEL company), and the total cDNA was obtained by using the extracted tea tree total RNA by Reverse Transcription System kit (Promega company), and the total cDNA was stored at -20°C. save.

Embodiment 2

[0036] Example 2: Obtaining the complete sequence of glutamine synthetase.

[0037] Design upstream and downstream primers cyGS-5' and cyGS-3':

[0038] cyGS-5' sequence: GAAAACAAACACACAGATAATATAA,

[0039] cyGS-3' sequence: TCATGGTTTCCACAGGATGGTGGTAG.

[0040] The total cDNA of tea tree was used as the template for PCR amplification. The PCR reaction program was: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute and 30 seconds, and 35 cycles of reaction; extension at 72°C for 10 minutes; storage at 4°C . 1% agarose gel electrophoresis to separate the PCR products, AxyPrep DNA Gel Recovery Kit (AXYGEN Company) to recover the PCR products, connected to the pMD19-T vector (TaKaRa Company), connected at 16°C overnight, and transferred the connection solution to the large intestine In E. coli DH5α competent cells, pour LB solid medium (containing Amp) and evenly spread 40 μl of 5-bromo-4...

Embodiment 3

[0043] Embodiment 3: Construction of pET28b-GS recombinant plasmid

[0044] Design primers:

[0045] cyGS-F1: CCATGGGCATGCATCATACTGAATCATCGTCGT;

[0046] cyGS-F2: CTCGAGAACACCCAACTGGTTTTGCACC, Nco I and Xho are underlined respectively

[0047] I restriction site.

[0048] Using the full sequence of the Cam-cyGS gene in Example 1 as a template, the protein coding region was amplified by PCR. The reaction conditions were: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute and 10 seconds, and 35 cycles of reaction ; Extend at 72°C for 10 minutes; Store at 4°C. Amplified product ( figure 2 ) and vector pET28b were digested with Nco I and Xhol I for 4 hours, connected and transformed into E. coli DH5α competent cells, poured on LB plates, screened positive clones, and obtained expression plasmid pET28b-GS. After identification by Nco I and XhoI double enzyme digestion ( image 3 ), sen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Relative molecular massaaaaaaaaaa
Login to View More

Abstract

The invention relates to a tea tree cytoplasm-type glutamine synthetase (GS) gene and an encoding protein thereof. The tea tree cytoplasm-type GS gene is obtained by taking a tea tree (Dragon Well tea 43) total complementary deoxyribonucleic acid (cDNA) as a template through polymerase chain reaction (PCR) amplification reaction. In the tea tree cytoplasm-type GS gene, part of homologous sequence published in national center of biotechnology information (NCBI) is utilized to design degenerate primer amplification to obtain an intermediate conserved sequence, and then, sequences of both ends are obtained through rapid amplification of cDNA Ends reaction; and the sequences of both ends are spliced through DNAman software to finally obtain the full-long sequence of tea tree cytoplasm glutamine synthetase, and the complete sequence analysis on the encoding zone of the gene is completed.

Description

technical field [0001] The present invention relates to a gene of tea tree cytoplasmic glutamine synthetase GS and the protein coded by the gene. Through the research of tea tree cytoplasmic glutamine synthetase GS genetic engineering technology, the tea tree nitrogen absorption rate and its Stress resistance belongs to the technical field of genetic engineering. Background technique [0002] Glutamine synthetase is widely distributed in plants. Glutamine synthetase is located in plants in the form of various isozymes, which are mainly divided into two categories: cytoplasmic GS1 and chloroplast GS2. GS1 is encoded by a multigene family and localized in the cytoplasm. GS2 is encoded by a single gene, mostly localized in chloroplasts. Isozymes are polypeptide chain monomers encoded by different gene loci or alleles in the same species or genus, which are in the state of pure polymers or heteropolymers. They have different primary structures, physical and chemical propertie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/52C12N9/00C12N15/63
Inventor 朱国萍翟羽佳王鹏王晖宣守芹潘蔚郑基阳高鹏
Owner ANHUI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com