Method for preparing human growth hormone recombinant
A technology of human growth hormone and solution, which is applied in the direction of preparation methods of growth hormone and peptides, methods based on microorganisms, etc., can solve the problems of low activity and low purity of human growth hormone, and achieve simplified purification process, high application value, rapid The effect of efficient separation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Embodiment 1: Construction and expression of nHGH gene expression vector:
[0020] 1) Construction of an alternate vector for pET-21b-PDI-pp
[0021] Design primers for PDI, including restriction sites, arranged from 5`-3` as follows:
[0022] PDI-S: GAGATATA CATATG GACGCCCCAGAGGAGGAGGACC
[0023] PDI-a: GCG GGATCC GGGCCCCTGGAACAGAACTTCCAG
[0024] CAGTTCATCTTTCAC
[0025] Primers were diluted to 50 pmol / ul, followed by a PCR step.
[0026] PCR reaction system 50ul:
[0027] wxya 2 O: 40ul
[0028] 10*PCR BUFFER 5ul
[0029] dNTP 1ul
[0030] Template: 1ul
[0031] Up / down stream primers: 1ul
[0032] pfu enzyme 1ul
[0033] PCR reaction conditions (Tag enzyme):
[0034] 94℃ 8min
[0035] 94°C 30s
[0036]65℃ 30s
[0037] 72℃ 1min 30 cycles
[0038] 72°C 10min
[0039] The PDI band was detected by agarose gel electrophoresis at about 1600bp. The target gene was recovered from the gel, and the cohesive end was cut with Nde I and BamH I. The pET-21b vecto...
Embodiment 2
[0067] Example 2: Purification of protein from nHGH stock solution
[0068] In high concentrations containing HIS 6 -FX-nHGH or HGH protein solution, adjust its pH value to 8.0. Prepare loading buffer:
[0069] MCAC-15MCAC-1000
[0070] 20mM Tris hydrochloride pH10.0 20mM Tris hydrochloride pH10.0
[0071] 0.5M NaCl 0.5M NaCl
[0072] 10% (v / v) glycerin (adjustable to 20%) 10% (v / v) glycerin
[0073] 15mMol / L imidazole 1M imidazole
[0074] Wash the nickel ion affinity column (Ni-NTA His-Bind Resin) column with MCAC-15 solution, then incubate the column with nHGH solution, shake gently at room temperature (preferably on ice) for 30 minutes. Then put on the column, use MCAC-60 to elute the impurity protein, and finally use MCAC-250 to elute the target protein. The resulting product was dialyzed overnight to obtain high-purity HIS 6 -FX-nHGH Boutique or HGH Boutique.
Embodiment 3
[0075] Embodiment three: identification of HGH high-quality goods after purification
[0076] First use SDS-PAGE to identify the concentration of the expression product:
[0077] Sample treatment solution: SDS 1g, Glycerol 5mL, bromophenol blue (BPB) solid trace, dithiothreitol (DDT) 2.5mL, solution B 25mL, add deionized water to 50mL
[0078] Take 10ul of nHGH solution after digestion, add 2ul of sample treatment solution, and place in boiling water bath for 5 minutes. The sample volume is 5ul / well. Standard protein molecular weights were treated similarly. Stain with Coomassie Brilliant Blue R-250. Such as Figure 4 As shown, SDS-PAGE analysis and activity detection were carried out, the leftmost line is the protein molecular weight control, and the middle is HIS 6 -FX-nHGH sample, the right side is the HGH sample after final digestion. Preliminary identification of the type of protein extracted.
[0079] Identification of expression products:
[0080] Human growth h...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com