Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Alkali-fast high-activity alkalescent xylanase and encoding gene thereof

A xylanase, high-activity technology, applied in the field of genetic engineering, can solve the problems of insufficient enzyme tolerance, low xylanase yield, restriction of large-scale use of enzymes, etc.

Inactive Publication Date: 2009-04-08
HUAZHONG AGRI UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to problems such as low yield of xylanase or insufficient tolerance of the enzyme, the large-scale use of the enzyme in industry is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alkali-fast high-activity alkalescent xylanase and encoding gene thereof
  • Alkali-fast high-activity alkalescent xylanase and encoding gene thereof
  • Alkali-fast high-activity alkalescent xylanase and encoding gene thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1 produces the screening method of the natural bacterial strain of xylanase

[0020] The marine bacterial strains (a total of 100 bacterial strains) provided by the China Marine Microorganism Culture Collection Center (Address: No. Sodium chloride, pH 7.0) after activation on the plate, single colonies were picked out on the enzyme-producing medium (1% xylan, 1% peptone, 1% yeast culture, 2% sodium chloride (NaCl), 0.2% phosphoric acid Dipotassium Hydrogen (K 2 HPO 4 ), 0.03% magnesium sulfate (MgSO 4 ), 0.02% calcium chloride (CaCl 2 ) and 1.5% agarose, pH 7.0) plate, cultured at 28°C for 36 hours, stained with 1% Congo red for 10-15 minutes, then decolorized with 1M NaCl, and picked the strains that produced larger transparent circles. After this experiment, a strain of Kocuria sp. Mn22 belonging to the genus Actinomyces was screened out, and the strain was named Kocuria sp.Mn22 for subsequent experiments.

Embodiment 2

[0021] The construction of embodiment 2 DNA library and the screening of xylanase positive clone

[0022] 1. Extract bacterial chromosomal DNA:

[0023] (1) The Kocuria sp.Mn22 bacterial strain screened in the embodiment is cultured with the high-salt LB liquid described in Example 1 after cultivating at 28°C for 24 hours, then take 1.5ml of bacterial liquid in a sterilized Ep tube, 12000 rpm Centrifuge for 1 minute, discard the supernatant, and collect the bacteria;

[0024] (2) Wash the bacteria twice with TE buffer (50mmol / LTris-HCl pH8.0, 10mmol / LEDTA pH8.0), then add 50μl 100μg / ml lysozyme (purchased from sigma company) to suspend the bacteria, and bathe at 37℃ One hour;

[0025] (3) Add 520 μl TE buffer, 30 μl 10% SDS and 3 μL 20mg / ml proteinase K (purchased from sigma company) and mix well, then bathe in water at 37°C for one hour;

[0026] (4) Then add 100 μl of 5mol / L sodium chloride solution and mix well, then add 80 μL of cetyltrimethylamine bromide (CTAB) / sodium...

Embodiment 3

[0044] The method for cloning, expressing and purifying xylanase Kxyn in Escherichia coli of embodiment 3

[0045] Construction of recombinant expression vector pGEX-6P-Kxyn:

[0046] According to the sequencing results, design primers, the sequence of the primer pair is as follows:

[0047] Forward primer (F): 5'-(BamHI)-ACC GGATCC ATGAGCAGACGAGCCCCCCT

[0048] Reverse primer (R): 5'-(EcoRI)-GCG GAATTC TCAGCGGAACGCGGGGT

[0049] Kxyn was amplified by PCR using pUC-Kxyn as a template. The PCR system is as follows:

[0050] 10×PCR buffer (purchased from TAKARA company) 5 μl

[0051] Mncl 2 (5mM) 3μl

[0052] dNTP (10mM) 1μl

[0053] Template plasmid pUC-Kxyn 1μl

[0054] Forward primer F (10μM) 1μl

[0055] Reverse primer R (10μM) 1μl

[0056] Taq DNA polymerase (purchased from Takara Bioengineering (Dalian) Co., Ltd., namely TAKARA, 2.5U / μl) 1 μl

[0057] Add deionized water to 50 μl

[0058] PCR conditions: 95°C pre-denaturation for 4 minutes; 95°C for 40 seco...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the genetic engineering technology field, and specifically relates to a new alkaline xylanase and a code gene thereof. The invention discloses a sequence of the gene and a coding area thereof. Escherichia coli DH5alpha / Mn22 / 6p / Kxyn which contains the gene plasmid is collected in China Center for Type Culture Collection (CCTCC) with the collection No. of M208201. The xylanase Kxyn is proved to have strong alkali resistance and thermal stability through the biological verification, thereby being capable of specially degrading xylan. The xylanase Kxyn can be used for paper making and other related fields.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to an alkali-resistant and highly active alkaline xylanase and the cloning of its gene. technical background [0002] Xylan is a hybrid five-carbon sugar. Most of the main chain is D-type xylopyranose connected by β-1,4 glycosidic bonds. The main side chain substituents are arabinose and glucose. Aldonic acid, 4-O-methylglucuronic acid, acetyl, galactosyl, etc. Xylan is the main component of hemicellulose, accounting for 1 / 3 of plant carbohydrates, and is the second largest renewable resource after cellulose. Therefore, hydrolysis of xylan is an important step in the utilization of hemicellulose. Xylanase is widely used as an additive in the feed industry, an improver in the food industry, and a biological bleaching agent for pulp in the paper industry (Polizeli et al., 2005). [0003] Xylanase was first used in the feed industry. Xylanase can destroy plant cell walls, release...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/56C12N9/42C12N1/21C12R1/19
Inventor 刘子铎李婵娟洪玉枝邵宗泽
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com