Test paper strip for detecting clostridium difficile toxin A and toxin B colloidal gold, method for making same and applications
A technology for Clostridium difficile and detection test strips, which is applied to measuring devices, instruments, scientific instruments, etc., can solve the problems of long time and complicated operation, and achieves the effects of simple operation, clear and easy to distinguish results, and easy promotion.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Preparation of Clostridium difficile A Toxin Gene Engineering Antigen
[0040] (1) Obtaining the target gene
[0041] According to the sequence of the target gene fragment (GenBank accession number is NC009012) and the characteristics of the pGEX-4T-1 (Pharmacia) expression vector, primers containing restriction enzymes EcoR1 and Xho1 restriction sites at both ends were designed:
[0042] 5'TCCGAATTGGGCCTCAACTGGTTATACAAGT3'
[0043]5'GTGCTCGAGAGGGGCTTTTACTCCATCAAC3'
[0044] Then, the target gene fragment was amplified from the genome. The amplification conditions were: denaturation at 95°C for 5 minutes; 1 minute at 95°C, 1 minute at 49.8°C, and 1 minute at 70°C for 35 cycles; finally, extension at 70°C for 10 minutes.
[0045] (2) Cloning of the target gene and screening of positive recombinants
[0046] After electrophoresis, the PCR amplified product was recovered by gel cutting, ligated with the PMD-18T cloning vector overnight at 16°C, transformed int...
Embodiment 2
[0055] Example 2: Preparation of Clostridium difficile B toxin genetically engineered antigen
[0056] (1) Amplification of the target gene
[0057] Refer to the Cd VPI10463 gene sequence included in GenBank, design primers, and add a suitable restriction endonuclease cutting site at its 5' end:
[0058] Upstream primer: 5'TCCGAATTCGCTTATGTCAACTAGTGAA3'
[0059] Downstream primer: 5'GCACTCGAGTTCACTA ATCACT AATTC3'
[0060] The total reaction system is 50ul: upstream primer (20pmol / L) 1ul, downstream primer (20pmol / L) 1ul, bacterial DNA template 2ul, dd H2044ul, added to the PCR amplification tube (PCR buffer, pfu enzyme and d NTPs have been added). Reaction conditions: Denaturation at 94°C for 45s, annealing at 60°C for 60s, extension at 72°C for 150s, after 39 cycles, extension at 72°C for 10min. The amplification results were observed by 1% agarose gel electrophoresis.
[0061] (2) Cloning of the target gene and screening of positive recombinants
[0062] After electrop...
Embodiment 3
[0071] Example 3 Development of Clostridium difficile A toxin monoclonal antibody
[0072] (1) Immunized mice
[0073] A toxin genetically engineered antigen was taken out from the -20°C low-temperature refrigerator and dissolved, and then subcutaneously injected into the back of BALB / C mice (0.2ml / mouse) with an interval of 10 days. Three days before the fusion, mice were challenged with 0.15 ml of antigen in the peritoneal cavity. The immune effect was detected by ELISA method.
[0074] (2) Myeloma cells
[0075] SP2 / 0 myeloma cells: Resuscitate the SP2 / 0 cells stored in the liquid nitrogen tank, and culture them in DMEM medium containing 10% calf serum for 48-72 hours. Uniform, neatly arranged, logarithmically split, ready for fusion.
[0076] (3) cell fusion
[0077] Prepared SP2 / 0 cells and splenic lymphocytes of immunized BALB / C mice were prepared in 2×10 7 / ml and 1×10 8 / ml. Take 1ml of each and mix at room temperature. 0.8 ml of 50% PEG (molecular weight 1500...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com