Granulocyte-macrophage colony stimulating factor gene modified allogene tumour cell vaccine
A technology for tumor cell and gene modification, which is applied to cells modified by introducing foreign genetic material, antineoplastic drugs, DNA/RNA fragments, etc. Efficiency differences, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1: Cloning of GM-CSF gene
[0029] 1.1 Amplification of GM-CSF gene
[0030] First, take 100 mg of human spleen tissue frozen at -80°C, such as "Molecular Cloning: A Laboratory Guide" by Sambrook et al., second edition, 1989, "Current Protocols In Molecular Biology Experiments" edited by F.M.Ausubel et al. ) (1987) described total tissue RNA extraction.
[0031] Then, use this as a template to design primers for RT-PCR experiments. The coding sequence of human GM CSF gene was searched in GenBank to determine the amplified region. GM-CSF gene coding sequence CDS (33-467, gi:27437029). Primer design using Olig6 software:
[0032] Outer upstream primer P1 5'GGCTAAAGTTCTCTGGAGGATGTG 3' (SEQ ID NO: 1)
[0033] Outer downstream primer P2 5'CTCATCTGGCCGGTCTCACTC 3' (SEQ ID NO: 2)
[0034] Internal upstream primer P3 5' GAATTC ATGTGGCTGCAGAGCCTG 3' (SEQ ID NO: 3)
[0035] Inner downstream primer P4 5' GGATCC TCACTCCTGGACTGGCTC 3' (SEQ ID NO: 4)
[0036] T...
Embodiment 2
[0060] Example 2: Preparation of GM-CSF Gene Modified Allogenic Tumor Cell Lines
[0061] Transfection method
[0062] Tumor cells in good condition were treated with 1.5×10 6 Inoculate / well in a 35mm six-well plate with 2ml of RPMI 1640 culture solution containing 10% fetal bovine serum at 37°C, 5% CO 2 1. Cultivate for 18-24 hours, so that 90-95% of the cells are in contact with each other on the day of transfection.
[0063] For each transfection well, prepare liposome complexes as follows:
[0064] DNA dilution preparation: Dissolve 4 μg of DNA from Example 1 in 250 μl Opti- I In antibiotic-free, serum-free medium, mix gently; liposome dilution preparation: mix LipofectamineTM 2000 gently before use, take 10μl and use Opti- Dilute to 250 μl in antibiotic-free, serum-free medium and mix gently. After incubating at room temperature for 5 minutes, the liposome dilution and the DNA dilution were mixed together and incubated at room temperature for 20 minutes to form a...
Embodiment 3
[0076] Embodiment 3: Preparation and inoculation of mouse tumor vaccine
[0077] The experimental mice are clean inbred strain C57BL / 6 (H-2Kb, female), 8-12 weeks old, weighing 18-22 g, purchased from Beijing Weitong Lihua Animal Center.
[0078] Using C57 mice inoculated with Lewis Lung Cancer (LLC) as an animal model, LLC and LA795 cells were used to prepare GM-CSF gene-modified autologous and allogeneic tumor vaccines, respectively, as described in Example 2.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com