Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Highly effective polypeptide for inhibiting angiogenesis, physical chemistry modifying method and application thereof

A technology of angiogenesis and angiogenesis inhibition, which is applied in the direction of cardiovascular system diseases, medical preparations with non-active ingredients, medical preparations containing active ingredients, etc., can solve the problems of insufficient vascular specificity and selectivity, production scale and Increased production costs, increased drug side effects, etc.

Inactive Publication Date: 2008-03-19
CHINA PHARM UNIV
View PDF0 Cites 24 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among these angiogenesis inhibitors, angiostatin and endostatin are the most eye-catching, both of which have entered clinical trials in the United States, although these vascular inhibitors present very attractive prospects , but its defects are also very obvious: so far, the targets of angiogenesis drugs, such as endostatin and angiostatin, are not clear, and their specificity and selectivity to blood vessels are not good enough, and the effect is limited, which leads to The dosage is very high. In the mouse animal model experiment, the dosage of angiostatin reaches hundreds of mg / kg body weight, and the dosage of endostatin reaches tens of mg / kg body weight. When these angiogenesis inhibitors are used in the human body, the dosage should be at least To achieve a dose of several grams / person
Such a large drug dosage will inevitably increase the possibility of toxic and side effects of this type of drug in the future, resulting in increased difficulty in quality control of this type of drug, increased production scale and production costs, and high drug prices.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Highly effective polypeptide for inhibiting angiogenesis, physical chemistry modifying method and application thereof
  • Highly effective polypeptide for inhibiting angiogenesis, physical chemistry modifying method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] 1. Cloning of RGD-ED gene and construction of its prokaryotic expression vector

[0040] The base encoding the RGD-ED polypeptide sequence was synthesized as a template; an upstream primer and a downstream primer were synthesized, wherein the upstream primer added an NdeI restriction site; the downstream primer contained an Arg-Gly-Asp sequence and an XhoI site. Perform PCR amplification, the amplified product is recovered and purified by agarose gel electrophoresis, digested with NdeI and XhoI, cloned into the prokaryotic expression vector pw, positive clones are screened by PCR, and the nucleotide sequence analysis confirms that the designed mutation has occurred in the sequence .

[0041] Synthetic primer 1: 5'GGAATTCCATATG ATCGTGCGCCGTGCCGACCGC3'

[0042] Synthetic primer 2: 5'CCGCTCGAGGCAGAAGCAGTCACCACGGCA3'

[0043] Among them, primer 1 encodes the partial sequence of NdeI site and Ile-Val-Arg-Arg-Ala-Asp-Arg-Ala-Ala-Val-Pro, primer 2 encodes XhoI site and conta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a high-performance angiogenesis inhibitor and a production method, which belongs to the field of the biological engineering pharmaceutical technology or protein polypeptide drugs. The invention designs a high-performance angiogenesis inhibitor RGD-ED with integrin compatibility, the inhibitor contains angiogenesis inhibition polypeptide isoleucine-valine-arginine-arginine-alanine-aspartate-arginine-alanine-alanine-valine-proline, and one or two ends of the inhibitor are respectively connected with polypeptides containing arginine-glycin-aspartate sequence. The RGD-ED of the invention can be synthesized. By the method of genetic engineering, the invention also expresses one of RGD-Eds in escherichia coli or other eukaryotic cells, and the RGD-ED is obtained by carrying out the separation, dissolution and renaturation of inclusion body protein and separation and purification by ion exchange chromatography. All the polypeptide sequences of the invention are modified by Polyethylene Glycol (PEG), heparin, dextran, polyvinylpyrrolidone (PVP), polyglycol-poly (amino acid) copolymer, palmitic acid, colominic acid and liposome, which includes liposome (REV), drying liposomal (DRV) and multivesicular liposome (Mvl). In vivo and in vitro experiments, the synthetic polypeptide sequence, product of genetic engineering and modified product of the invention can notably increase the effects of inhibiting the growth of endothelial cells, inhibiting angiogenesis and resisting tumor of the present angiogenesis inhibitors, and moreover, the high-performance angiogenesis inhibitor can be used as a drug curing solid tumors and rheumatoid arthritis.

Description

[0001] 1. Technical field: the present invention belongs to the field of bioengineering and pharmaceutical technology or the field of protein and polypeptide drugs. 2. Background technology [0002] Tumor angiogenesis inhibitors are a class of drugs that have attracted attention in the treatment of tumors in recent years. Some progress has been made in this area of ​​research, and they are expected to become a new class of promising drugs for tumor treatment in the future. The concept of tumor neovascularization was proposed by Algureza in 1947, who pointed out that an important feature of growing tumors is the ability to initiate the formation of new capillary endothelial cells from the host. In 1971, Folkman put forward the hypothesis that tumor growth and metastasis depend on angiogenesis, and that solid tumors can secrete tumor angiogenesis factors in the early stage to stimulate host capillary proliferation. Neovascularization can not only provide the nutrients and oxygen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K7/06C07K7/08A61K38/08A61K38/10A61P35/00
CPCA61K47/48215C07K7/06A61K47/48246C07K7/08A61K38/08A61K38/10A61K47/60A61K47/64A61P35/00A61P9/00Y02A50/30
Inventor 徐寒梅周康
Owner CHINA PHARM UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products