Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

38 results about "Odorant Receptor" patented technology

Olfactory receptor. Olfactory receptors (ORs), also known as odorant receptors, are expressed in the cell membranes of olfactory receptor neurons and are responsible for the detection of odorants (i.e., compounds that have an odor) which give rise to the sense of smell.

Modulators of odorant receptors

The present invention relates to polypeptides capable of promoting odorant receptor cell surface localization and odorant receptor functional expression. The present invention further provides assays for the detection of ligands specific for various odorant receptors. Additionally, the present invention provides methods of screening for odorant receptor accessory protein polymorphisms and mutations associated with disease states, as well as methods of screening for therapeutic agents, ligands, and modulators of such proteins.
Owner:DUKE UNIV

Methods of reducing the perception of body odors with olfactory adaptation and cross-adapting agents

Deodorant compositions are disclosed comprising a cross-adapting agent, alone or in combination with other such agents, in an amount effective to reduce perception of malodor. Deodorant compositions are also disclosed comprising a cross-adapting agent, alone or in combination with other such agents, in an amount effective to reduce perception of gender-specific malodor. The methods feature reducing perceived body odor comprising administering a deodorant composition wherein the composition comprises an amount of cross-adapting agent effective to reduce perception of such odor. Other methods feature blocking perceived body odor comprising administering a deodorant composition wherein the composition comprises an amount of cross-adapting agent effective to occupy an odorant receptor site, thereby blocking interaction of the site with other odorants. Methods of making deodorant compositions are also provided wherein a cross-adapting agent, alone or in combination with other such agents, are included in an amount effective to reduce perception of malodor.
Owner:MONELL CHEM SENSES CENT

Nucleic acids and proteins of insect or83b odorant receptor genes and uses thereof

The present invention relates to insect odorant receptor genes and methods for identifying odorant receptor genes. The invention provides nucleotide sequences of insect odorant receptor genes Or83b, amino acid sequences of their encoded proteins (including peptides or polypeptides), and related products and methods. The nucleic acids of the invention may be operatively linked to promoter sequences and transformed into host cells. Methods of production of an Or83b odorant receptor protein (e.g., by recombinant means), and derivatives and analogs thereof, are provided. Antibodies to an Or83b odorant receptor protein, and derivatives and analogs thereof, are provided. Methods for identifying molecules that bind or modulate the activity of these Or83b odorant receptor genes are provided. Molecules found to bind or modulate the activity of Or83b genes may be formulated into pest control agents by providing a carrier. In a preferred embodiment, molecules that bind or modulate the activity of an Or83b gene form one species but not others is desired. Methods to modify the insect behaviour by modifying an insect Or83b odorant are also provided.
Owner:SENTISEARCH

Sensor Device and Methods

The invention provides a sensor device comprising an insect odorant receptor (OrX) in electrical communication with a substrate, wherein the sensor device is configured to detect a change in an electrical characteristic of the substrate. The invention also provides sensor device component comprising an insect odorant receptor (OrX) in electrical communication with a substrate. The invention also provides methods for manufacture and use of the sensor device and sensor device component. The invention also provides methods of use of the sensor to detect an analyte.
Owner:THE NEW ZEALAND INST FOR PLANT & FOOD RES LTD

Metabolic diseases-related odorant receptor genes and use thereof

The present invention relates to a diagnostic kit for metabolic diseases selected from the group consisting of obesity, dyslipidemia, fatty liver, and insulin resistance syndrome, and a method for screening a therapeutic composition for said diseases. The invention provides a large number of new gene targets for metabolic diseases such as obesity and the like, thereby enabling a more reliable diagnosis of genes such as obesity and the like and the use in the screening of a therapeutic candidate material based on the new gene targets.
Owner:IND ACADEMIC CORP FOUND YONSEI UNIV

Methods of identifying, isolating and using odorant and aroma receptors

Provided here are new methods to identify specific families of mammalian odorant receptors for odorants or aroma, particularly indole and skatole malodors and their use in assays that may be used to discover compounds that modulate (blocking, enhancing, masking or mimicking compounds) their activity. Orphan mouse odorant receptors are identified from olfactory sensory neurons that respond to target compounds. The resulting receptors as well as their human counterparts can be screened in assays against test compounds to confirm their identity as odorant or aroma receptors, particularly malodor receptors and subsequently discover for example modulators that inhibit the perception of the malodor in humans.
Owner:FIRMENICH SA

Compositions and methods for enhancing odorant receptor activity

ActiveUS20130004983A1Increases potency and efficacyHigh expressionMicrobiological testing/measurementVertebrate cellsOdorant receptor activityOdorant Receptor
The present invention relates to polypeptides capable of modulating odorant receptor activation. In particular, the present invention provides polypeptides (e.g., type 3 muscarinic actetylcholine receptor M3) capable of enhancing odorant receptor activation. The present invention further provides assays for the detection of ligands specific for various odorant receptors. Additionally, the present invention provides methods of screening for polypeptide polymorphisms and mutations associated with odorant receptor activation (e.g., polymorphisms and mutations associated with muscarinic actetylcholine receptor polypeptides (e.g., M1, M2 M3, M4, M5)), as well as methods of screening for therapeutic agents, ligands, and modulators of such proteins.
Owner:DUKE UNIV

Biosensor exhibiting sensitivity to trinitrotoluene

A biosensor for detecting trinitrotoluene (TNT) is disclosed. The biosensor has cells, such as olfactory sensory neurons (or cilia derived therefrom), that preferentially express a TNT-responsive odorant receptor protein.
Owner:RES FOUND THE CITY UNIV OF NEW YORK

Methods for vapor detection and discrimination with mammalian odorant receptors expressed in heterologous cells

ActiveUS20190250148A1Enhanced odorant responseImprove responseBiological testingHeterologousGas phase
The present invention relates to an odorant receptor based odorant sensor system and related methods. In particular, systems and methods are provided permitting detection and discrimination of an odorant molecule in a vapor / gaseous phase using a panel of odorant receptors expressed in heterologous cells.
Owner:DUKE UNIV

Compositions and methods for characterizing and regulating olfactory sensation

The present invention relates to the characterization of odorant receptors. In particular, the present invention relates to the OR7D4 proteins and nucleic acids encoding OR7D4 proteins and cell systems for screening for modulators of OR7D4 receptors. The present invention further provides assays for the detection of OR7D4 polymorphisms and mutations associated with altered olfactory sensation states, as well as methods of screening for therapeutic agents, ligands, and modulators of OR7D4 receptors.
Owner:THE ROCKEFELLER UNIV +1

Odorant receptor co-receptor

The present invention provides an insect odorant receptor co-receptor that exhibits excellent detection sensitivity of odorants when bound with an odorant receptor to form an odorant receptor complex.This odorant receptor co-receptor is provided with the following first amino acid sequence and second amino acid sequence which follows the amino acid residue furthest on the carboxyl-terminal side of the first amino acid sequence: (1) a first amino acid sequence which is a partial amino acid sequence of an odorant receptor co-receptor of a first insect or a variant of the receptor, and which isan amino acid sequence that is continuous from the amino-terminal of the first insect odorant receptor co-receptor or the variant thereof to any amino acid residue positioned in the range of 20 aminoacid residues before and after the amino acid residue furthest on the carboxyl-terminal side in the fourth transmembrane domain; and (2) a second amino acid sequence which is a partial amino acid sequence of an odorant receptor co-receptor of a second insect of a different variety than the first insect or a variant of the receptor, and which, in an alignment analysis of the amino acid sequence ofthe first insect odorant receptor co-receptor or the variant thereof and the amino acid sequence of the second insect odorant receptor co-receptor or the variant thereof, is an amino acid sequence that is continuous from one carboxyl-terminal-side amino acid residue, said residue being in a position in the second insect odorant receptor co-receptor or the variant thereof that corresponds to the amino acid residue furthest on the carboxyl-terminal side of the first amino acid sequence, to the carboxyl-terminal of the second insect odorant receptor co-receptor or the variant thereof.
Owner:SUMITOMO CHEM CO LTD

Mosquito arrestin 2 polypeptides

The invention discloses a polynucleotide and polypeptide of arrestin 2. Also disclosed are methods for producing such polypeptide. This invention also discloses a method of identifying compounds that bind to arrestin 2 or odorant receptors. A method of identifying compounds that inhibit the binding of mosquito arrestin 2 to a mosquito odorant receptor is also disclosed.
Owner:VANDERBILT UNIV

Method for enhanced functional expression of cell receptors

The invention relates to methods for enhancing functional expression of receptor molecules in recombinant cells, preferably heterologous cells. In the method, a eukaryotic cell is transformed or transfected with all of the nucleic acid molecule which encodes the receptor, one which encodes a GEF, such as Ric-8A or Ric-8B, and one which encodes Gαolf. The resulting, recombinant cells are then contacted with an agent that stimulates the functional expression of the receptor. Preferably, the receptor is an odorant receptor, or “OR,” and the agent is a ligand for that OR.
Owner:UNIV DE SAO PAULO

System and methods for detection of volatile organic compounds in air

A biochip for detection of volatile organic compounds in air includes one or more wells for holding living cells. A capillary connecting each well to a liquid source may be used. The liquid source may be an on-chip reservoir or a system liquid supply. An air flow channel is separated from each well by a membrane. At least a portion of the biochip is transparent to allow optical detection of cell fluorescence. The biochip may be made of multiple flat transparent layers attached together. A system for detecting volatile organic compounds in air has an optical system adapted to detect fluorescence of genetically modified living cells expressing an odorant receptor capable of binding to the volatile organic compound and a calcium sensitive fluorescent reporter that fluoresces in response to binding of the volatile organic compound to the odorant receptor.
Owner:KONIKU INC

Olfactory receptor as microglia marker and use thereof

Provided are an odorant receptor marker of microglia and a use thereof, and according to the odorant receptor marker of microglia and a use thereof according to one aspect, microglia may be detected by measuring an activity or expression level of a protein of an odorant receptor (OR) Olfr110 or Olfr111, and OR ligands of microglia may be selected using them, and an inhibitor or activator against the interaction between the OR and 2-pentylfuran is effectively used in treatment of a neuroinflammatory disease or meningitis.
Owner:DAEGU GYEONGBUK INST OF SCI & TECH

DNA sequence that increases odorant receptor representation in the olfactory system

A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.
Owner:RES FOUND THE CITY UNIV OF NEW YORK

Cell Lines For Screening Odorant And Aroma Receptors

Provided herein is a cell line with improved odorant receptor function comprising an activated endogenous RTP1 gene, which further expresses an RTP1 protein. Further provided herein is a method for specifically activating an endogenous RTP1 gene in a eukaryotic cell using a CRISPR / Cas9 derived technique. Also provided herein is a method for identifying compounds with desired effects such as perfume or aroma modulators in said cell line.
Owner:FIRMENICH SA

DNA sequence that increases odorant receptor representation in the olfactory system

A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.
Owner:RES FOUND THE CITY UNIV OF NEW YORK

Olfactory receptor expression libraries and methods of making and using them

This invention provides novel libraries of olfactory receptor odorant / ligand-binding domains and methods of making and using them. The invention also provides libraries of vectors and cells comprising these nucleic acid constructs. The compositions and methods of the invention are used to identify novel ligand-binding domains for olfactory neuron odorant receptors and their ligands. Thus, the compositions and methods of the invention can be used to generate novel odorants, to screen for toxic odorants, or to manipulate an animal's olfactory response.
Owner:THE JOHN HOPKINS UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products