Novel gene and protein encoded by the gene
a gene and gene technology, applied in the field of recombinant polypeptides, can solve the problems of insufficient reliability of model predictive abilities, and achieve the effect of identifying and purifying proteins
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Examples
Embodiment Construction
[0093] The present invention will now be further described by means of examples that are not intended to limit the present invention. The various gene manipulations employed in the examples are according to the methods described in the above Current Protocols in Molecular Biology (edited by Frederick M. Ausubel et al., 1987).
(1) Construction of cDNA Library Derived from Human Adult Whole Brain, Human Adult Hippocampus and Human Embryonic Whole Brain
[0094] Double-stranded cDNA was synthesized using an oligonucleotide having Not-I site (GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15) (Invitrogen) as a primer, mRNAs (Clontech) derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain as templates, and a SuperScriptII reverse transcriptase kit (Invitrogen). Next, an adaptor (Invitrogen) having SalI site was ligated to the cDNA, followed by digestion with NotI and 1% low-melt agarose electrophoresis. Thus, DNA fragments of 3 kb or more were purified...
PUM
Property | Measurement | Unit |
---|---|---|
Volume | aaaaa | aaaaa |
Volume | aaaaa | aaaaa |
Fraction | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com