Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel gene and protein encoded by the gene

a gene and gene technology, applied in the field of recombinant polypeptides, can solve the problems of insufficient reliability of model predictive abilities, and achieve the effect of identifying and purifying proteins

Inactive Publication Date: 2006-03-23
PROTEIN EXPRESS +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0027] Further, the entire region of a human-derived gene containing the DNA of the present invention can also be prepared by a PCR method, such as RACE, while exercising proper care so as not to cause short fragments or any artificial mistakes in obtained sequences.
[0038] The polypeptide consisting of an amino acid sequence which is substantially identical to the above amino acid sequence represented by any one of SEQ ID NOS: 1 to 70, or the polypeptide comprising an amino acid sequence derived from the above amino acid sequence by deletion, substitution or addition of a section of the amino acids can be easily produced by, for example, an appropriate combination of methods known by a person skilled in the art, such as site-directed mutagenesis, homologous recombination of genes, primer elongation and PCR.
[0070] Solvents used for activation of protected amino acids and condensation with resin can be appropriately selected from solvents known in the art as applicable to polypeptide condensation reaction, such as acid amides, halogenated hydrocarbons, alcohols, sulfoxides and ethers. A reaction temperature is appropriately selected from a known range that can be used for reaction of polypeptide linkage formation. Activated amino acid derivatives are normally used in 1.5 to 4-fold excess. When condensation is insufficient as a result of a test using ninhydrin reaction, sufficient condensation can be performed by repeating condensation reaction without eliminating protecting groups. When condensation is still insufficient even when reaction is repeated, unreacted amino acids are acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction.
[0080] Moreover, for patients who cannot exert normal in vivo functions because of abnormalities or deletions in the DNA or the gene of the present invention, or because the expression amount of the DNA or the gene of the present invention is reduced, it is effective that the DNA or the gene construct of the present invention is introduced for expression into the bodies of the patients by gene therapy using as vehicles appropriate vectors, such as retrovirus vectors, adenovirus vectors and adenovirus-associated virus vectors according to known techniques. Further, when patients cannot exert normal functions because of an increased expression amount, introduction of antisense can be effective.
[0087] Further, polypeptide chip prepared by arraying the polypeptides of the present invention can be a strong tool for functional analysis on the expression, interaction and posttranslational modification of the polypeptides of the present invention, and for identification and purification of proteins.

Problems solved by technology

However, these models' predictive abilities are not yet sufficiently reliable.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0093] The present invention will now be further described by means of examples that are not intended to limit the present invention. The various gene manipulations employed in the examples are according to the methods described in the above Current Protocols in Molecular Biology (edited by Frederick M. Ausubel et al., 1987).

(1) Construction of cDNA Library Derived from Human Adult Whole Brain, Human Adult Hippocampus and Human Embryonic Whole Brain

[0094] Double-stranded cDNA was synthesized using an oligonucleotide having Not-I site (GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15) (Invitrogen) as a primer, mRNAs (Clontech) derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain as templates, and a SuperScriptII reverse transcriptase kit (Invitrogen). Next, an adaptor (Invitrogen) having SalI site was ligated to the cDNA, followed by digestion with NotI and 1% low-melt agarose electrophoresis. Thus, DNA fragments of 3 kb or more were purified...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Volumeaaaaaaaaaa
Volumeaaaaaaaaaa
Fractionaaaaaaaaaa
Login to View More

Abstract

Novel DNAs containing the regions which encode proteins have been directly cloned from cDNA libraries derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain, the nucleotide sequences thereof have been determined, and their functions have been identified. The present invention provides DNA which comprises the nucleotide sequence encoding the following polypeptide (a) or (b): (a) a polypeptide comprising an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70; (b) a polypeptide comprising an amino acid sequence derived from the amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids, and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a); a recombinant polypeptide, which is encoded by the above DNA; and a protein containing the polypeptide.

Description

TECHNICAL FIELD [0001] The present invention relates to DNA and a gene containing the DNA, and a recombinant polypeptide encoded by the DNA and a novel recombinant protein containing the polypeptide. BACKGROUND ART [0002] An enormous amount of information on the nucleotide sequence of the human genome has been obtained by large-scale sequencing in the Human Genome Project and analysis of the information is continuing on a daily basis. [0003] The ultimate goal of the Human Genome Project is not just simple determination of the entire nucleotide sequence of the genome, but also the elucidation of various human life phenomena based on the structural information, that is the nucleotide sequence information of DNA. [0004] Only limited regions of the human genome sequence encode proteins. Currently, the coding regions are predicted by the neural network or an information science technique, called the Hidden Markov Model. However, these models' predictive abilities are not yet sufficiently...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C07H21/02C12P21/06C12M1/34C07K14/47C07K16/18A61P13/08A61P15/00A61P35/00C12N15/12
CPCC07K14/47A61K2039/505A61P13/08A61P15/00A61P35/00
Inventor OHARA, OSAMUNAGASE, TAKAHIRONAKAJIMA, DAISUKE
Owner PROTEIN EXPRESS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products