Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for joint investigating hepatitis B virus pro S1 antigen and nuclear antigen and diagnostic kit

A technology of hepatitis B virus and core antigen, applied in the field of hepatitis B virus detection, can solve the problem of lack of effective detection of hepatitis B virus and other problems

Active Publication Date: 2006-11-29
XIAMEN UNIV +1
View PDF1 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Therefore, this area still lacks the method for effectively detecting hepatitis B virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for joint investigating hepatitis B virus pro S1 antigen and nuclear antigen and diagnostic kit
  • Method for joint investigating hepatitis B virus pro S1 antigen and nuclear antigen and diagnostic kit
  • Method for joint investigating hepatitis B virus pro S1 antigen and nuclear antigen and diagnostic kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0111] Embodiment 1 is used as the GST-2147*6 antigen preparation of antigen

[0112] template preparation

[0113] Using proteinase K-phenol:chloroform method, HBV DNA was extracted from serum specimens of chronic hepatitis B patients (No. 263) stored in-house. Multiple primers were designed, HBV gene was isolated by PCR, and cloned into pMD18-T vector (Takara NO.CK2401) for sequencing. The GenBank accession number of the assembled full-length HBV sequence is AF233236, and the full-length genome of the HBV strain is 3068bp, which belongs to the adw2 subtype. The cloning plasmid pT-PreS contains the full-length PreS1 and PreS2 genes. The sequence is as follows:

[0114] atgggaggttggtcttccaaacctcgacaaggcatggggacaaatctttctgttcc

[0115] caatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaa

[0116] acaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggta

[0117] ggagcggggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggag

[0118] ccctcaggctcagggcatattgacaac...

Embodiment 2

[0130] Example 2 Production of hybridoma cell lines 3H5, 7H11, 2A7, 4D11, 6F1, 13G2, 16F5

[0131] Immunization of mice and fusion of splenocytes and hybridomas

[0132] Female Balb / c mice aged 6-8 weeks were taken, and each mouse was initially immunized with 5 μg GST-2147*6 recombinant antigen emulsified with Freund's complete adjuvant (total volume 50 μl). After 15 days, the second basic immunization was carried out by emulsifying the same amount of antigen with Freund's incomplete adjuvant and injecting it intramuscularly. After 30 days, the tail vein was boosted with 5 μg antigen without adjuvant, and 72 hours after the booster immunization, the mice were killed, the blood was collected, the spleen was taken to prepare the spleen cell suspension (suspended in RPMI 1640 medium), and the cell counting plate cell counts. Take the cultured SP2 / 0 mouse myeloma cells according to 1 / 6 of the number of splenocytes, mix them and centrifuge, and use polyethylene glycol (PEG1500) t...

Embodiment 3

[0153] Example 3 Screening of high-affinity HBV PreS1-coated monoclonal antibody and enzyme-labeled monoclonal antibody

[0154] Preparation of HBV PreS1 enzyme-labeled monoclonal antibody:

[0155] The modified sodium periodate method was used. Take labeled 20mg 3H5 monoclonal antibody as an example: Accurately weigh 40mg of HRP, add 2ml of 0.2M pH5.6 acetate buffer, dissolve and add 0.06M NaIO 4 Solution 2ml, react at room temperature for 20 minutes; add 0.16M ethylene glycol-10% NaCl solution 2ml, react at room temperature for 20 minutes, put the enzyme solution into a dialysis bag, and dialyze against 0.001M pH4.0 acetate buffer overnight; add 0.8ml of 2M pH9.6 carbonate buffer solution, add 20mg of 3H5 monoclonal antibody, stir and react at 4°C for 2 hours; add freshly prepared NaBH 4Solution (5mg / ml) 0.4ml, stirred reaction at 4 ℃ for 2 hours; drop saturated (NH 4 ) 2 SO 4 Solution 9.2ml,; 4°C stirring reaction for 30 minutes, 4°C 3500 rpm centrifugation for 20 minu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Ph valueaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method of diagnosing hepatitis B virus (HBV) infection by combined detection for HBV related pre-S1 antigen (HBV PreS1) and core antigen (HBcAg). And the invention also discloses a method for detecting HBV PreS1 by double-antibody sandwich method. And the invention also discloses a reagent box and virus lysate for the above detection and their uses.

Description

field of invention [0001] The invention relates to the field of hepatitis B virus detection, and more specifically relates to a method for diagnosing hepatitis B virus infection through combined detection of hepatitis B virus-related pre-S1 antigen (HBV PreS1) and core antigen (HBcAg). At the same time, the invention discloses a combined detection kit (especially enzyme-linked immunoassay and chemiluminescence method) of hepatitis B virus pre-S1 antigen and core antigen. The invention also relates to a detection method of the pre-S1 antigen, a virus lysing method and related kits. Background of the invention [0002] Hepatitis B virus infection is one of the most important public health problems worldwide. [0003] At present, HBV serum markers (conventional such as: HBsAg, HBsAb, HBeAg, HBeAb, HBcAb commonly known as "two-and-a-half" detection) are widely used as routine detection standards for current HBV infection and past HBV infection. However, the high mutation rate ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569G01N33/577G01N33/543
CPCG01N33/5762G01N2333/02G01N33/56983G01N33/5764
Inventor 葛胜祥袁权赵昱罗文新张军夏宁邵
Owner XIAMEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com