Method for joint investigating hepatitis B virus pro S1 antigen and nuclear antigen and diagnostic kit
A technology of hepatitis B virus and core antigen, applied in the field of hepatitis B virus detection, can solve the problem of lack of effective detection of hepatitis B virus and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0111] Embodiment 1 is used as the GST-2147*6 antigen preparation of antigen
[0112] template preparation
[0113] Using proteinase K-phenol:chloroform method, HBV DNA was extracted from serum specimens of chronic hepatitis B patients (No. 263) stored in-house. Multiple primers were designed, HBV gene was isolated by PCR, and cloned into pMD18-T vector (Takara NO.CK2401) for sequencing. The GenBank accession number of the assembled full-length HBV sequence is AF233236, and the full-length genome of the HBV strain is 3068bp, which belongs to the adw2 subtype. The cloning plasmid pT-PreS contains the full-length PreS1 and PreS2 genes. The sequence is as follows:
[0114] atgggaggttggtcttccaaacctcgacaaggcatggggacaaatctttctgttcc
[0115] caatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaa
[0116] acaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggta
[0117] ggagcggggagcattcgggccagggttcaccccaccacacggcggtcttttggggtggag
[0118] ccctcaggctcagggcatattgacaac...
Embodiment 2
[0130] Example 2 Production of hybridoma cell lines 3H5, 7H11, 2A7, 4D11, 6F1, 13G2, 16F5
[0131] Immunization of mice and fusion of splenocytes and hybridomas
[0132] Female Balb / c mice aged 6-8 weeks were taken, and each mouse was initially immunized with 5 μg GST-2147*6 recombinant antigen emulsified with Freund's complete adjuvant (total volume 50 μl). After 15 days, the second basic immunization was carried out by emulsifying the same amount of antigen with Freund's incomplete adjuvant and injecting it intramuscularly. After 30 days, the tail vein was boosted with 5 μg antigen without adjuvant, and 72 hours after the booster immunization, the mice were killed, the blood was collected, the spleen was taken to prepare the spleen cell suspension (suspended in RPMI 1640 medium), and the cell counting plate cell counts. Take the cultured SP2 / 0 mouse myeloma cells according to 1 / 6 of the number of splenocytes, mix them and centrifuge, and use polyethylene glycol (PEG1500) t...
Embodiment 3
[0153] Example 3 Screening of high-affinity HBV PreS1-coated monoclonal antibody and enzyme-labeled monoclonal antibody
[0154] Preparation of HBV PreS1 enzyme-labeled monoclonal antibody:
[0155] The modified sodium periodate method was used. Take labeled 20mg 3H5 monoclonal antibody as an example: Accurately weigh 40mg of HRP, add 2ml of 0.2M pH5.6 acetate buffer, dissolve and add 0.06M NaIO 4 Solution 2ml, react at room temperature for 20 minutes; add 0.16M ethylene glycol-10% NaCl solution 2ml, react at room temperature for 20 minutes, put the enzyme solution into a dialysis bag, and dialyze against 0.001M pH4.0 acetate buffer overnight; add 0.8ml of 2M pH9.6 carbonate buffer solution, add 20mg of 3H5 monoclonal antibody, stir and react at 4°C for 2 hours; add freshly prepared NaBH 4Solution (5mg / ml) 0.4ml, stirred reaction at 4 ℃ for 2 hours; drop saturated (NH 4 ) 2 SO 4 Solution 9.2ml,; 4°C stirring reaction for 30 minutes, 4°C 3500 rpm centrifugation for 20 minu...
PUM
Property | Measurement | Unit |
---|---|---|
Ph value | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap