Non-viral vector based on DNAzyme catalytic oligopeptide covalent assembly as well as preparation method and application of non-viral vector

A non-viral vector, short peptide technology, used in recombinant DNA technology, other methods of inserting foreign genetic materials, pharmaceutical formulations, etc., can solve problems such as instability of organic compounds

Active Publication Date: 2021-07-23
ANHUI NORMAL UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the residual toxicity of catalysts in the synthesis process is still unavoidable, and low nucleic acid loading and instability of organic synthesis are the key issues in the current synthesis of carriers.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Non-viral vector based on DNAzyme catalytic oligopeptide covalent assembly as well as preparation method and application of non-viral vector
  • Non-viral vector based on DNAzyme catalytic oligopeptide covalent assembly as well as preparation method and application of non-viral vector
  • Non-viral vector based on DNAzyme catalytic oligopeptide covalent assembly as well as preparation method and application of non-viral vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] A method for preparing a non-viral vector based on DNAzyme catalyzed covalent assembly of short peptides, the preparation method comprising the following steps:

[0044](1) Heat an appropriate amount of nucleic acid rich in G base sequence to 90°C one week in advance, take it out after 10 minutes, cool it to room temperature, and then store it in the upper layer of the refrigerator at a temperature of 4-10°C, waiting for the formation of the G4 structure; The gene sequence of the nucleic acid rich in G base sequence is: 3'-TTGGGTTGGGTTGGGTTGGGTTTT CAGCGTGCGCCATCCTTCCCATCCTCCTCC -5', the underlined part is the ASO sequence that can reduce the expression of the anti-apoptotic protein Bcl-2, if it is replaced with a nucleic acid sequence that can treat other diseases, the targeted treatment of other diseases can also be achieved;

[0045] (2) Add 50uL 2μM hemin solution to 50uL 1μM G4 solution, incubate at 37°C for 3h to form a G4 / hemin solution;

[0046] (3) Mix 200 μL ...

Embodiment 2

[0050] Others are with embodiment 1, when carrying out step (4), add H 2 o 2 After the aqueous solution, start the test by adding H 2 o 2 The ultraviolet absorption diagram of the sample test system at different times after the aqueous solution, the test time is cut off at 150min; the results are as follows image 3 shown. It can be seen from the figure that adding H 2 o 2 After 50 minutes of aqueous solution, the basic reaction is completed, and the UV absorbance value at this time reaches the maximum, which also proves the success of the covalent cross-linking of the short peptide and the successful preparation of a non-viral vector.

Embodiment 3H2

[0051] Example 3H 2 o 2 The concentration of aqueous solution and optimization of incubation conditions

[0052] Others are the same as in Example 1, when performing step (4), add 10 μL of 1 mM H 2 o 2 Aqueous solution, test once every 5 minutes, the whole experiment 60 minutes, detect the corresponding fluorescence intensity, such as Figure 4 As shown in a), the result shows that the 50min basic reaction is completed;

[0053] H in Example 1 2 o 2 The concentration of the aqueous solution was replaced by 50μМ, 100μМ, 200μМ, 400μМ, 800μМ, 1mM, 2mM, 5mM, and after incubation at 37°C for 40min, the fluorescence intensity corresponding to different concentrations was detected at the excitation wavelength of 315nm, as shown in Figure 4 As shown in b), the result shows that H 2 o 2 The optimal concentration of the aqueous solution is 1 mM.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Sizeaaaaaaaaaa
Login to view more

Abstract

The invention discloses a non-viral vector based on DNAzyme catalytic oligopeptide covalent assembly as well as a preparation method and application of the non-viral vector. The preparation method comprises the steps that an oligopeptide chain carrying positive charges and a G4 structure of nucleic acid carrying negative charges are subjected to electrostatic binding, then in the presence of hydrogen peroxide, oligopeptide covalent cross-linking is catalyzed through the horseradish peroxidase-like effect of G4 / hemin, 20-70nm hovenia acerba dendritic three-dimensional porous structure nanofibers are synthesized, the nanofibers are hydrolyzed under the action of trypsin to release protected nucleic acid ASO, and the protected nucleic acid ASO is bound with mRNA of a target through complementary base pairing, so that the target RNA is cut by RNase H to trigger gene silencing, and further the expression of anti-apoptosis protein Bcl-2 is reduced. According to the method, the material being simple in synthesis, low in toxicity, high in load and high in stability is obtained.

Description

technical field [0001] The invention belongs to the technical field of gene delivery carriers, and in particular relates to a non-viral carrier based on DNAzyme-catalyzed covalent assembly of short peptides, a preparation method and application thereof. Background technique [0002] Gene delivery is a vital part of gene therapy's effectiveness. It refers to the purpose of treating diseases by transferring specific genetic material (DNA or RNA) into the patient's cells. However, due to defects such as immune rejection, inability to pass through the cell membrane, and easy degradation by nucleases, a safe and effective gene delivery system is inevitably needed to help encapsulate and deliver nucleic acids to effective locations in cells. [0003] There are generally two types of gene delivery: viral vectors and non-viral vectors. Due to the poor targeting of viral vectors, it is difficult for drugs to accumulate in tumor sites. At the same time, the capacity of carrying genes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/87A61K48/00
CPCC12N15/87A61K48/0025Y02A50/30
Inventor 王广凤李娜
Owner ANHUI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap