Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of high-quality porcine nuclear transplantation donor cells

A technology for expressing vectors and vector skeletons, applied in biochemical equipment and methods, chemical instruments and methods, cells modified by introducing foreign genetic materials, etc., can solve the problem of inactivation of receptor proteins, inability to infect live pigs, and reduced infectivity And other issues

Active Publication Date: 2021-05-11
NANJING KGENE GENETIC ENG CO LTD
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Destroying the pAPN gene will inactivate the receptor protein encoded by it, the TGEV virus cannot infect live pigs, and the infectivity of PEDV and PDCoV viruses to pigs is also greatly reduced

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of high-quality porcine nuclear transplantation donor cells
  • Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of high-quality porcine nuclear transplantation donor cells
  • Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of high-quality porcine nuclear transplantation donor cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0093] Embodiment 1, the construction of plasmid

[0094] 1.1 Construction of plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (plasmid pKG-GE3 for short)

[0095] The sequence of the original plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (abbreviated as plasmid pX330) is shown in SEQ ID NO.1. The schematic diagram of the structure of plasmid pX330 is shown in figure 1 . In SEQ ID NO.1, the 440-725 nucleotides form the CMV enhancer, the 727-1208 nucleotides form the chickenβ-actin promoter, and the 1304-1324 nucleotides encode the SV40 nuclear localization signal (NLS ), the 1325-5449th nucleotide encodes the Cas9 protein, and the 5450-5497th nucleotide encodes the nucleoplasmin nuclear localization signal (NLS).

[0096] Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO ( Figure 5 ), referred to as plasmid pKG-GE3, the nucleotide is shown in SEQ ID NO.2. Compared with the plasmid pX330, the plasmid pKG-GE3 has been mainly modified as follows: ① Remove the residual gRNA backbone seque...

Embodiment 2

[0109] Example 2 Plasmid Proportion Optimization and Effect Comparison of Plasmid pX330 and Plasmid pKG-GE3

[0110] 2.1 Target gRNA design and construction

[0111] 2.1.1 Using Benchling to design target gRNA for RAG1 gene

[0112] RAG1-g4: AGTTATGGCAGAACTCAGTG (SEQ ID NO. 9)

[0113] Synthesize complementary DNA Oligo for the insertion sequence of the above-mentioned RAG1 gene target as follows:

[0114] RAG1-gRNA4S: caccgAGTTATGGCAGAACTCAGTG (SEQ ID NO.10)

[0115] RAG1-gRNA4A: aaacCACTGAGTTCTGCCATAACTc (SEQ ID NO.11)

[0116] Both RAG1-gRNA4S and RAG1-gRNA4A are single-stranded DNA molecules.

[0117] 2.1.2 Primers designed to amplify and detect fragments containing the RAG1 gRNA target

[0118] RAG1-nF126: CCCCATCCAAAGTTTTTAAAGGA

[0119] RAG1-nR525: TGTGGCAGATGTCACAGTTTAGG

[0120] 2.1.3 Construction and cloning of gRNA recombinant vector

[0121] 1) Digest 1ug pKG-U6gRNA plasmid with restriction endonuclease BbsI;

[0122] 2) run the digested pKG-U6gRNA plasmid o...

Embodiment 3

[0170] Example 3 Screening of efficient MSTN gene gRNA targets

[0171] Pig MSTN gene information: encoding myostatin protein; located on pig chromosome 15; GeneID is 399534, Susscrofa. The protein encoded by the porcine MSTN gene is shown in GENBANK ACCESSION NO.NP_999600.2 (linear CON12-JAN-2018), and the amino acid sequence is shown in SEQ ID NO.13. In the genomic DNA, the porcine MSTN gene has 3 exons, wherein the first exon and its downstream 200bp sequences are shown in SEQ ID NO.14.

[0172] 3.1 MSTN gene knockout predetermined target and conservation analysis of adjacent genome sequences

[0173] 18 newborn Congjiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) and 8 males (named A, B, C, D , E, F, G, H).

[0174] Using the genomic DNA of 18 pigs as a template, PCR amplification was performed using primer pairs (the target sequence of the primer pair includes the first exon of porcine MSTN gene), followed by electrophoresis. The PCR amplificatio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and resistant to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of the high-quality porcine nuclear transplantation donor cells. A CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / CRISPR associated protein 9) system for porcine MSTN-SST-CD163-pAPN four-gene editing contains a Cas9 expression vector and gRNA (guide Ribonucleic Acid) expression vectors aiming at a porcine MSTN gene, an SST gene, a CD163 gene and a pAPN gene, and plasmid complete sequence of the Cas9 expression vector is as shown in SEQ ID NO.2. According to the invention, the corresponding gRNA expression vectors are designed for different targets of MSTN, SST, CD163 and pAPN genes, and gRNA with relatively high editing efficiency and the gRNA expression vector are obtained through screening. Through cooperation with the modified Cas9 efficient expression vector for gene editing, the editing efficiency is remarkably improved as compared with that of an original vector.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for constructing high-quality pig nuclear transplantation donor cells with high lean meat rate, fast growth and resistance to blue ear disease and serial diarrhea diseases and its application, in particular to the use for MSTN, SST, CD163, pAPN Four-gene edited CRISPR / Cas9 system and its application in the construction of high-quality pig nuclear transfer donor cells with high lean meat percentage, fast growth and resistance to PRRS and serial diarrheal diseases. Background technique [0002] Pig is one of the earliest domesticated domestic animals in my country, and it has always been an important meat animal for human beings in the long river of history. The Chinese love to eat pork is related to the food culture for thousands of years. Since 2000, pork has accounted for more than 70% of my country's meat consumption, and it is the most important meat consumed in my country...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/65C12N5/10A01K67/027
CPCC12N15/8509C07K14/47C12N15/65A01K67/0276C12N2310/20A01K2227/108A01K2267/02A01K2267/025
Inventor 牛冬汪滔马翔曾为俊刘璐王磊程锐赵泽英段星陶裴裴黄彩云
Owner NANJING KGENE GENETIC ENG CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com