Human parathyroid hormone eukaryotic expression recombinant plasmid vector and construction method thereof
A technology of parathyroid hormone and eukaryotic expression vectors, applied in the field of recombinant plasmid vector construction, can solve the problems of increasing the difficulty of drug use, limiting large-scale use, instability, etc., and achieves easy large-scale standardized production, easy storage and transportation, The effect of stable performance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1: Construction of recombinant plasmid vector for eukaryotic expression of human parathyroid hormone ( figure 2 ).
[0039] 1. Synthesis, amplification and digestion of the target gene.
[0040](1) Artificially synthesized cDNA (SEQ ID NO. 1) of human parathyroid hormone (PTH1-84aa).
[0041] (2) Using the synthesized PTH gene as a template, design primers, which are characterized in that the primers are designed based on the target gene sequence, and a BamHI restriction site is inserted at the 5' end of the upstream primer, and a BamHI restriction site is inserted at the 5' end of the downstream primer. One XhoI restriction site: p1 (BamH I): CTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGGGTGTGTGTATGTG; p2 (XhoI): CATGGTCTTTGTAGTCCTCGAGCTGGGATTTAGCTTTAGTTAATACAT. The designed primer sequences were sent to Shenggong for synthesis. Dilute the synthesized primers into a stock solution with a final concentration of 10 µmol / L.
[0042] (3) Perform PCR amplification using...
Embodiment 2
[0086] Example 2: Expression Verification
[0087] 1. PHY-PTH transfection 293T cell experiment.
[0088] (1) One day before transfection, inoculate an appropriate number of cells into the cell culture plate, so that the cell density at the time of transfection can reach 70-90%.
[0089] (2) For each transfection sample, prepare Lipofectamine® 2000-DNA mixture as follows.
[0090] a. Before use, take 10μL Lipofectamine® 2000 Transfection Reagent
[0091] For optimization without serum, dilute in medium (Opti-MEM), and vortex for 2-3s to fully mix the reagents.
[0092] b. Dilute DNA (4µg) with serum-free Opti-MEM (125µL) and mix gently.
[0093] c. Gently mix (a) the diluted Lipofectamine® 2000 with the above (b) diluted DNA as soon as possible, and incubate in a chamber for 5 minutes to form a Lipofectamine® 2000-DNA mixture.
[0094] (3) Cells were transfected in a 10 cm dish in a serum-free medium, and the transfection complex was added for 24 hours and then replaced wi...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com