Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus licheniformis with enhanced ppc expression and preparation method and application

A technology of bacillus licheniformis and its construction method, which is applied in the field of bacillus licheniformis and its preparation, and can solve the problems of not analyzing the function of PpC

Active Publication Date: 2022-07-05
LIFECOME BIOCHEM
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] PpC is a phosphoenolpyruvate carboxylase, which plays a role in the central carbon metabolism of organisms. However, the current research has not resolved the specific function of PpC

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus licheniformis with enhanced ppc expression and preparation method and application
  • Bacillus licheniformis with enhanced ppc expression and preparation method and application
  • Bacillus licheniformis with enhanced ppc expression and preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0028] a reinforcement ppc The concrete operation steps of the construction method of the expressed Bacillus licheniformis are:

[0029] 1. The specific operation steps of step (1) are:

[0030] According to the genomic DNA sequence of Corynebacterium glutamicum ATCC 13032 ppc gene sequence, design ppcThe upstream primer (ppc-F) and the downstream primer (ppc-R) of the gene; and using the genomic DNA of Corynebacterium glutamicum ATCC 13032 as the template, respectively ppc The upstream and downstream primers of the gene were amplified by PCR ppc Gene fragment (2760bp, such as figure 1 shown);

[0031] Among them, the sequences of ppc-F and ppc-R are:

[0032] ppc-F: TAAGAGAGGAATGTACACATGACTGATTTTTTACGCGATGA,

[0033] ppc-R:TCCGTCCCTCTCTGCTCTTCTAGCCGGAGTTGCGCAGCGCA;

[0034] Then the P43 promoter was obtained by PCR amplification of the genomic DNA of Bacillus subtilis 168 (the primers used were P43-F and P43-R), and the amylase terminator was obtained by PCR amplific...

Embodiment 15

[0077] The difference between Example 15 and Example 14 is: in step (1), the Bacillus subtilis genomic DNA is amplified by PCR to obtain the Pppc promoter, while the Bacillus licheniformis DW2 genomic DNA is used as a template to obtain starch by PCR amplification enzyme terminator, followed by the Pppc promoter, ppc The gene fragment and the amylase terminator were joined together by overlap extension PCR to obtain ppc A gene fragment with a Pppc promoter connected upstream and an amylase terminator downstream connected to the gene fragment is a complete gene fragment. ppc Expression element, the remaining steps are the same as in Example 14, and finally the double exchange is successful ppc The integrated strain was named: Bacillus licheniformis DW2-ppc-1;

Embodiment 16

[0079] The difference between Example 16 and Example 14 is that: in step (1), the P43 promoter is obtained by PCR amplification of Bacillus subtilis genomic DNA, and the Tppc terminator is obtained by PCR amplification of Bacillus subtilis genomic DNA at the same time, Then the P43 promoter, ppc The gene fragment and the Tppc terminator were linked together by overlap extension PCR to obtain ppc A gene fragment with a P43 promoter connected upstream of the gene fragment and a Tppc terminator connected downstream at the same time is a complete gene fragment. ppc Expression element, the remaining steps are the same as in Example 14, and finally the double exchange is successful ppc The integrated strain was named: Bacillus licheniformis DW2-ppc-2.

[0080] The Bacillus licheniformis DW2-ppc-1 and Bacillus licheniformis DW2-ppc-2 constructed in Example 15 and Example 16 were respectively subjected to seed and production culture. The bacitracin titer test data in the fermentatio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides an enhanced ppc Expressed Bacillus licheniformis and preparation method and application, wherein the strengthening ppc Bacillus licheniformis was expressed by inserting the phosphoenolpyruvate carboxylase gene derived from Corynebacterium glutamicum ATCC 13032 into the genome of Bacillus licheniformis DW2 ppc The prepared Bacillus licheniformis DW2‑ppc. Compared with Bacillus licheniformis DW2, the bacitracin production of Bacillus licheniformis DW2‑ppc was increased by more than 12%.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering bacteria transformation, in particular to an enhanced phosphoenolpyruvate carboxylase gene ppc Expressed Bacillus licheniformis and preparation method and application. Background technique [0002] Bacitracin is a class of cyclic peptide antibiotics composed of 12 amino acid residues, and its constituent amino acids include ornithine (Orn), D-phenylalanine (D-Phe), isoleucine (His), D-Aspartic Acid (D-Asp), Asparagine (Asn), Lysine (Lys), D-Glutamic Acid (D-Glu), Cysteine ​​(Cys), Leucine (Leu) ), isoleucine (Ile) and valine (Val) 11 amino acids. Bacitracin, also known as subtilisin, can inhibit or kill certain pathogenic bacteria, effectively inhibit the growth of Gram-positive bacteria such as Clostridium spp., and interact with other antibiotics (such as penicillin, gentamicin, etc.) It has a synergistic enhancement effect; in addition, bacitracin is hardly absorbed in the intest...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/75C07K7/58C12P21/04C12R1/10
CPCC12N9/88C12Y401/01031C12N15/75C07K7/58C12P21/02
Inventor 陈守文蔡冬波吴非杨帆李俊辉陈晓斌季潇炜楼丽君邱湘琪
Owner LIFECOME BIOCHEM
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com