Bacillus licheniformis with enhanced ppc expression and preparation method and application
A technology of bacillus licheniformis and its construction method, which is applied in the field of bacillus licheniformis and its preparation, and can solve the problems of not analyzing the function of PpC
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0028] a reinforcement ppc The concrete operation steps of the construction method of the expressed Bacillus licheniformis are:
[0029] 1. The specific operation steps of step (1) are:
[0030] According to the genomic DNA sequence of Corynebacterium glutamicum ATCC 13032 ppc gene sequence, design ppcThe upstream primer (ppc-F) and the downstream primer (ppc-R) of the gene; and using the genomic DNA of Corynebacterium glutamicum ATCC 13032 as the template, respectively ppc The upstream and downstream primers of the gene were amplified by PCR ppc Gene fragment (2760bp, such as figure 1 shown);
[0031] Among them, the sequences of ppc-F and ppc-R are:
[0032] ppc-F: TAAGAGAGGAATGTACACATGACTGATTTTTTACGCGATGA,
[0033] ppc-R:TCCGTCCCTCTCTGCTCTTCTAGCCGGAGTTGCGCAGCGCA;
[0034] Then the P43 promoter was obtained by PCR amplification of the genomic DNA of Bacillus subtilis 168 (the primers used were P43-F and P43-R), and the amylase terminator was obtained by PCR amplific...
Embodiment 15
[0077] The difference between Example 15 and Example 14 is: in step (1), the Bacillus subtilis genomic DNA is amplified by PCR to obtain the Pppc promoter, while the Bacillus licheniformis DW2 genomic DNA is used as a template to obtain starch by PCR amplification enzyme terminator, followed by the Pppc promoter, ppc The gene fragment and the amylase terminator were joined together by overlap extension PCR to obtain ppc A gene fragment with a Pppc promoter connected upstream and an amylase terminator downstream connected to the gene fragment is a complete gene fragment. ppc Expression element, the remaining steps are the same as in Example 14, and finally the double exchange is successful ppc The integrated strain was named: Bacillus licheniformis DW2-ppc-1;
Embodiment 16
[0079] The difference between Example 16 and Example 14 is that: in step (1), the P43 promoter is obtained by PCR amplification of Bacillus subtilis genomic DNA, and the Tppc terminator is obtained by PCR amplification of Bacillus subtilis genomic DNA at the same time, Then the P43 promoter, ppc The gene fragment and the Tppc terminator were linked together by overlap extension PCR to obtain ppc A gene fragment with a P43 promoter connected upstream of the gene fragment and a Tppc terminator connected downstream at the same time is a complete gene fragment. ppc Expression element, the remaining steps are the same as in Example 14, and finally the double exchange is successful ppc The integrated strain was named: Bacillus licheniformis DW2-ppc-2.
[0080] The Bacillus licheniformis DW2-ppc-1 and Bacillus licheniformis DW2-ppc-2 constructed in Example 15 and Example 16 were respectively subjected to seed and production culture. The bacitracin titer test data in the fermentatio...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com