Preparation method of porcine circovirus type 3 (PCV-3) Cap protein virus-like particles and application thereof
A porcine circovirus and virus-like technology is applied in the field of preparation of porcine circovirus type 3 Cap protein virus-like particles, which can solve the problems of low secretion efficiency, low solubility of target protein, low production cost, etc., and improve the expression efficiency of yeast Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1. Preparation of virus-like particles of recombinant porcine circovirus expressed by Saccharomyces cerevisiae
[0038] 1. Obtain the recombinant PCV3-Cap protein gene sequence
[0039] (1) Obtain the immunogenic gene Cap of PCV3 from the plasmid containing the whole genome sequence of PCV3 preserved by our company.
[0040] (2) Design primers A1, A2, B1, and B2 (see Table 1 for the sequence), and use Overlap PCR to add a signal peptide sequence before the Cap region, as follows:
[0041] (5'-ATGATGGTGTCCTTCACCTCCCTCCTCGCCGGCGTCGCCGCCATCTCGGGCGTCTTGGCCGCTCCCGCCGCCGAGGTCGAATCCGTGGCTGTGGAGAAGCGC-3')
[0042] (3) Then optimize the sequence after adding the signal peptide. The specific method is: add the restriction site of BsaI and the base sequence (GATG) for the correct connection of the transcription units in order at the 5' end of the signal peptide, ORF2 His6-Tag (5'-CATCATCACCATCACCAT-3'), BsaI enzyme cutting site and base sequence (TAGC) for the correct co...
Embodiment 2
[0056] Example 2. Preparation of virus-like particles of recombinant porcine circovirus expressed in Escherichia coli
[0057] 1. The Cap protein obtained in 1. of Example 1 was optimized according to the codon preference of E. coli, and then transformed into the expression host E. coli BL21. Correct clones were obtained by screening LB plates with kana resistance.
[0058] 2. Induced expression of recombinant bacterial Cap protein
[0059] 1) Pick a single colony from the resistant plate and inoculate it in a medium containing LB, and culture it overnight at 37°C;
[0060] 2) Transfer the bacterial solution obtained in step 1 to a 500 mL Erlenmeyer flask containing 50 mL of LB medium at an inoculum size of 1%, and culture it with shaking at 37°C until OD 620nm is 0.6;
[0061] 3) Add IPTG with a final concentration of 1 mM to the above culture medium, and induce expression at 16° C. for 8 h on a shaker.
[0062] 4) Collect the cells and wash them twice with PBS, then resu...
Embodiment 3
[0074] Example 3. Vaccine preparation and immune test of virus-like particles of recombinant porcine circovirus
[0075] 1. Vaccine Preparation
[0076] The virus-like particles of the group of porcine circoviruses expressed by Saccharomyces cerevisiae in Example 1 are mixed with aluminum hydroxide glue and recorded as Z; the virus-like particles of the group of porcine circoviruses expressed by E. Particles are mixed with aluminum hydroxide glue and recorded as Y, and the virus-like particles of the recombinant porcine circovirus without adding signal peptide PCV3-Cap protein in Comparative Example 1 are mixed with aluminum hydroxide glue and recorded as Y. For Z-1, the virus-like particles of the group porcine circovirus expressed by Pichia pastoris in comparative example 3 are mixed with aluminum hydroxide glue and recorded as Z-B, and the above-mentioned 4 kinds of vaccines are used according to the "People's Republic of China Veterinary Medicine Code "for sterility test,...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com