Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of ornithine cyclohexanase in improving yield of ibuprofen A produced by bacillus amylolyticus

A technology of amylolytic spores and iturin, applied in the field of genes and biological fermentation, to achieve the effect of increasing yield and yield

Active Publication Date: 2019-11-15
HUBEI UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there is no report on the use of ornithine cyclohexanase of Corynebacterium glutamicum to increase iturin A

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ornithine cyclohexanase in improving yield of ibuprofen A produced by bacillus amylolyticus
  • Application of ornithine cyclohexanase in improving yield of ibuprofen A produced by bacillus amylolyticus
  • Application of ornithine cyclohexanase in improving yield of ibuprofen A produced by bacillus amylolyticus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Construction of engineering strain LX-12 / pHY-ocd containing ornithine cyclohexylase plasmid:

[0024] 1. Design primers (ocd-F and ocd-R); use Corynebacterium glutamicum ATCC 13032 genomic DNA as a template to amplify the ocd gene sequence (1761bp) including the enzyme cleavage site;

[0025] ocd-F: CGGAATCCCTCCCTGCTGTGGAGGGAACCA

[0026] ocd-R:GCTCTAGACTTCGTCTTCCTTGCCGGTGCT;

[0027] The ocd gene sequence is shown in SEQ ID NO.1.

[0028] 2. Use EocRI and XbaI restriction endonucleases to double-enzyme digest the target gene fragment to obtain a gene fragment (1759bp). (4870bp); Wherein, the restriction endonuclease EocRI and XbaI restriction endonuclease are purchased from Beijing Quanshijin Biotechnology Co., Ltd.;

[0029] 3. The digested gene fragment and the linearized plasmid fragment were subjected to T 4 DNA ligase was connected to obtain the ligated product; the ligated product was transformed into Escherichia coli DH5α by the calcium chloride transformati...

Embodiment 2

[0034] Application of ornithine cyclohexylase in improving the production of iturin A by Bacillus amyloliquefaciens:

[0035] In this embodiment, for different fermentation medium formulations, the iturin A-producing ability of the engineering strain LX-12 / pHY-ocd was investigated (also inoculated with Bacillus amyloliquefaciens LX-12 in these 18 mediums at the same time) / pHY300 as a contrast), 18 groups of medium formulations are specifically shown in Table 1:

[0036] Table 1 Different fermentation medium formula pH6.9~7.2

[0037]

[0038]

[0039] The specific steps for obtaining the seed solution are as follows: first activate Bacillus amyloliquefaciens, that is, inoculate 1% by volume from a glycerol tube into 5mL LB medium, culture at 250r / min and 37°C for 12 hours, and then activate The bacterium solution was inoculated in the fermentation medium in Table 1 with a volume percentage of 1% inoculum, and cultivated for 12 hours at 250r / min and 37°C to obtain a see...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene and biological fermentation, and discloses the application of ornithine cyclohexanase in improving the yield of ibuprofen A produced by bacillus amylolyticus. A plasmid pHY300PLK is used as a basis, by constructing an over-expression vector pHY-ocd of ornithine cyclohexanase Ocd from corynebacterium glutamicum, expression of a gene ocd is promoted in thebacillus amylolyticus LX-12 successfully, and bacillus amylolyticus engineered strains LX-12 / pHY-ocd are obtained. Compared with control strains LX-12 / pHY300, the yield of IturinA of the engineered strains LX-12 / pHY-ocd is increased by at least 37%.

Description

technical field [0001] The invention belongs to the field of gene and biological fermentation, and specifically relates to the application of ornithine cyclohexanase in increasing the yield of iturin A produced by bacillus amyloliquefaciens. Background technique [0002] Iturin A is a lipopeptide secondary metabolite mainly synthesized by Bacillus subtilis and Bacillus amyloliquefaciens. Its molecular structure contains a peptide chain composed of seven amino acid residues and a β-amino fatty acid Side chain, amino acid composition including asparagine (Asn), glutamine (D-Gln), serine (L-Ser), proline (L-Pro), tyrosine (D-Tyr), due to Iturin A It can inhibit the reproduction and growth of plant fungal diseases, so it has important application value in the field of plant biological control. At present, lipopeptide antibiotics are mainly used in the fields of agricultural biological control, medicine, oil exploration, food preservation, environmental management and cosmetics....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/52C12P21/04C12R1/07
CPCC12N9/00C12P21/02
Inventor 陈守文蔡冬波许玉享杨勇马昕高林王瑞任晓红丁才夫
Owner HUBEI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More