Lactic acid bacteria antimicrobial peptides and their high expression and application of antibacterial and anticancer activities
A technology of antibacterial peptides and lactic acid bacteria, applied in medical preparations, applications, peptides and other directions containing active ingredients, to achieve the effects of strong stability, inhibition of value-added, and strong bacteriostatic ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Preparation of a novel lactic acid bacteria antimicrobial peptide LHH1, the nucleotide sequence of which is as follows;
[0039]
[0040] Bsa I and HindIII restriction endonuclease sites and protective bases were added to both ends, and the protective bases were part of the two tails. The amino acid sequence, molecular weight, charge number, isoelectric point and hydrophobicity of the antimicrobial peptide LHH1 are respectively: AFALIAGALYRIFHRR, 1875.25, +3, 11.71, 0.98.
[0041] The second technical problem to be solved by the present invention is to provide a method for constructing the above-mentioned engineering bacteria. The technical scheme is as follows:
[0042] The present invention amplifies the gene sequence of antimicrobial peptide LHH1 by fully synthesizing it through PCR technology, and the primer sequence is:
[0043] F: TTTGGTCTCCAGGTGATGATGATGATAAAGCGTTTGCCTTAATCG
[0044] R: GGGGGGAAGCTTTCATTAACGACGATGAAATA
[0045] PCR reaction system: double di...
Embodiment 2
[0047] Construction of Antimicrobial Peptide LHH1 Recombinant Escherichia coli Genetic Engineering Bacteria
[0048] (1) Construction of cloning vector
[0049] The gene glue of the antimicrobial peptide was connected with pE-SUMO, transformed into the competent cells of Escherichia coli DH 5α, and the correctness of the test results was verified.
[0050] Preparation of competent cells: For specific methods, refer to the steps in the instructions of TaKaRa Competent Cell Preparation Kit (200 times).
[0051] Gel recovery of PCR products: For specific methods, refer to the steps in the instruction manual of the column-type small volume gel recovery kit. After completion, 5 μL of the recovered product was detected by electrophoresis on 2% Agarose gel containing EB.
[0052] Insert the LHH1 gene into the multiple cloning site of the Escherichia coli expression vector to construct the LHH1 recombinant plasmid: Digest the LHH1 gene and the pE-SUMO plasmid with Bsa I and HindIII,...
Embodiment 3
[0062] Induced Expression of Antimicrobial Peptide LHH1 Fusion Protein
[0063] The recombinant bacteria with correct sequencing results and the control bacteria containing empty vector were inoculated in LB (calamycin) liquid medium at an inoculum of 1%, and after culturing at 220r / min at 37°C overnight, inoculated at 10mL with an inoculum of 1%. LB (calamycin) liquid medium, 37 ° C, 220r / min shaking culture until OD 600 is 0.6, respectively take 1.0mL bacterial liquid as the pre-induction control (0h), and then add IPTG (final concentration 100mg / mL) to induce expression, continue to culture at 25°C, and take 1.0 mL of bacterial liquid 4 hours after induction, collect the bacterial cells by centrifugation at 12000r / min for 1min, and perform ultrasonic lysis. Ultrasonic crushing was performed at 180W for 20 minutes in ice water. Then, centrifuge at 12000r / min for 1min to collect the cell lysate, resuspend in PBS, take 10ul and add 40μL of 1× protein loading buffer, bath in ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com