Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Novel lactic acid bacterium antibacterial peptide and application of high-efficiency expression and antibacterial anti-cancer activity

A technology of antimicrobial peptides and lactic acid bacteria, applied in the fields of genetic engineering and biology, can solve the problems of inapplicability to large-scale production and high cost, and achieve good antibacterial and anticancer activities, inhibition of value-added, and strong stability

Active Publication Date: 2019-08-09
TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The first two are not suitable for large-scale production due to high cost, and the method of genetic engineering expression is more and more recognized by everyone

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel lactic acid bacterium antibacterial peptide and application of high-efficiency expression and antibacterial anti-cancer activity
  • Novel lactic acid bacterium antibacterial peptide and application of high-efficiency expression and antibacterial anti-cancer activity
  • Novel lactic acid bacterium antibacterial peptide and application of high-efficiency expression and antibacterial anti-cancer activity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Preparation of a novel lactic acid bacteria antimicrobial peptide LHH1, the nucleotide sequence of which is as follows;

[0039]

[0040] Bsa I and Hind III restriction endonuclease sites and protective bases are added to both ends, and the protective bases are the two tail parts. The amino acid sequence, molecular weight, charge number, isoelectric point and hydrophobicity of the antimicrobial peptide LHH1 are respectively: AFALIAGALYRIFHRR, 1875.25, +3, 11.71, 0.98.

[0041] The second technical problem to be solved by the present invention is to provide a method for constructing the above-mentioned engineering bacteria. The technical solution is as follows:

[0042] The present invention amplifies the gene sequence of antimicrobial peptide LHH1 by fully synthesizing it through PCR technology, and the primer sequence is:

[0043] F: TTTGGTCTCCAGGTGATGATGATGATAAAGCGTTTGCCTTAATCG

[0044] R: GGGGGGAAGCTTTCATTAACGACGATGAAATA

[0045] PCR reaction system: double dist...

Embodiment 2

[0047] Construction of Antimicrobial Peptide LHH1 Recombinant Escherichia coli Genetic Engineering Bacteria

[0048] (1) Construction of cloning vector

[0049] The gene glue of the antimicrobial peptide was connected with pE-SUMO, transformed into the competent cells of Escherichia coli DH 5α, and the correctness of the test results was verified.

[0050] Preparation of competent cells: For specific methods, refer to the steps in the instructions of TaKaRa Competent Cell Preparation Kit (200 times).

[0051] Gel recovery of PCR products: For specific methods, refer to the steps in the instruction manual of the column-type small volume gel recovery kit. After completion, 5 μL of the recovered product was detected by electrophoresis on 2% Agarose gel containing EB.

[0052] Insert the LHH1 gene into the multiple cloning site of the Escherichia coli expression vector to construct the LHH1 recombinant plasmid: Digest the LHH1 gene and the pE-SUMO plasmid with Bsa I and Hind III...

Embodiment 3

[0062] Induced Expression of Antimicrobial Peptide LHH1 Fusion Protein

[0063] The recombinant bacteria with correct sequencing results and the control bacteria containing empty vector were inoculated in LB (calamycin) liquid medium at an inoculum of 1%, and after culturing at 220r / min at 37°C overnight, inoculated at 10mL with an inoculum of 1%. LB (calamycin) liquid medium, 37 ° C, 220r / min shaking culture until OD 600 is 0.6, respectively take 1.0mL bacterial liquid as the pre-induction control (0h), and then add IPTG (final concentration 100mg / mL) to induce expression, continue to culture at 25°C, and take 1.0 mL of bacterial liquid 4 hours after induction, collect the bacterial cells by centrifugation at 12000r / min for 1min, and perform ultrasonic lysis. Ultrasonic crushing was performed at 180W for 20 minutes in ice water. Then, centrifuge at 12000r / min for 1min to collect the cell lysate, resuspend in PBS, take 10ul and add 40μL of 1× protein loading buffer, bath in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel lactic acid bacterium antibacterial peptide and application of high-efficiency expression and antibacterial anti-cancer activity. A gene sequence of an antibacterial peptide LHH1 is obtained by analyzing a gene map of L.casei HZ1, the secondary structure of the antibacterial peptide LHH1 is simulated as shown in a sequence 1, and the main physical and chemical properties of the peptide are determined. An LHH1 gene is optimized and completely synthesized according to the codon preference of lactic acid bacteria, the gene fragment is cloned into a lactic acid bacterium expression vector pE-SUMO, and a pE-SUMO-EA-LHH1 recombinant plasmid is constructed. The recombinant plasmid is transformed into escherichia coli Rosetta (DE3) pLysS, and induced expression, separation and purification are conducted on the recombinant plasmid. The obtained antibacterial peptide LHH1 is strong in thermal stability, has good antibacterial and anticancer effects, and can be used as an excellent antiseptic additive and a starter in the industries of foods, medicines, feeds and the like.

Description

technical field [0001] The invention relates to the fields of genetic engineering and biotechnology, in particular to the high-efficiency expression of a novel lactic acid bacteria antibacterial peptide LHH1 and the application of antibacterial and anticancer activities. Background technique [0002] Since the 1990s, the research on new antibacterial substances such as antimicrobial peptides has been increasing. Among them, the family of antibacterial active peptides such as defensins and histatin (Histatin) is a natural component of the human immune system, which has strong antibacterial activity and less toxic side effects. , less drug-resistant strains and other advantages, has attracted much attention. Antimicrobial peptides are induced when the body is attacked by viruses, bacteria, etc., and are part of the innate immune mechanism of animals, plants, and humans. They have broad-spectrum antibacterial effects, especially for some pathogenic bacteria that are resistant t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K7/08C12N15/31C12N15/70A61K38/10A61P35/00
CPCC07K7/08C12N15/70A61P35/00A61K38/00
Inventor 罗学刚贺军芳金杜欣俞晓亭张同存
Owner TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com