Human mesothelin chimeric antigen receptor and T cell, preparation method and use thereof
A technology of chimeric antigen receptors and cells, applied in the field of tumor treatment, can solve problems such as limiting the effective activation of specific T cells
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0082] Example 1. Construction of mesothelin recombinant protein expression plasmid
[0083] The mesothelin cDNA fragment was synthesized in vitro, the HIS tag was added to the tail, and the restriction sites EcoR1 and BglII were introduced at both ends, and cloned into the expression vector pCAGGS to construct a recombinant eukaryotic expression plasmid of the full-length mesothelin protein. The above work was completed by Suzhou Hongxun Company.
[0084] The cDNA sequence of mesothelin recombinant protein is as follows:
[0085] ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTT GCACTTGTCACGAATTCGGAAGTGGAGAAGACAGCCTGTCCTTC AGGCAAGAAGGCCCGCGAGATAGACGAGAGCCTCATCTTCTACA AGAAGTGGGAGCTGGAAGCCTGCGTGGATGCGGCCCTGCTGGCC ACCCAGATGGACCGCGTGAACGCCATCCCCTTCACCTACGAGCA GCTGGACGTCCTAAAGCATAAACTGGATGAGCTCTACCCACAAG GTTACCCCGAGTCTGTGATCCAGCACCTGGGCTACCTCTTCCTCA AGATGAGCCCTGAGGACATTCGCAAGTGGAATGTGACGTCCCTG GAGACCCTGAAGGCTTTGCTTGAAGTCAACAAAGGGCACGAAAT GAGTCCTCAGGTGGCCACCCTGATCGACCGCTTTGTGAAGGGAAGGGGCCAGCTAGA...
Embodiment 2
[0086] Example 2. Expression and purification of mesothelin protein
[0087] 1) Transfection of HEK293T cells (purchased from Shanghai Cell Bank, BNCC338274): 18 hours before transfection, HEK293T cells were transfected at 1.5x10 7 / ml to 30 15cm petri dishes; take 37.5mL DMEM (purchased from Gibco, C11995500CP) (without serum and antibiotics) into a 50mL tube, add 2970μg polyetherimide (PEI) MegaTran 1.0 (purchased from Alfa Aesar, 9002-98-6) mixed; take 37.5mL DMEM (without serum and antibiotics) into a 50mL tube, add mesothelin plasmid DNA 990μg mixed; add PEI / DMEM solution to the prepared DNA solution , Mix quickly and let stand at room temperature for 15 minutes; respectively take 2.5ml of PEI / DNA / DMEM mixture into each petri dish at 37℃, 5% CO 2 Cultivate in the incubator. 6 hours after transfection, carefully aspirate the culture medium, add 25ml of new culture medium DMEM+2% FBS (purchased from Gibco, 10270) + 0.12% double antibody (Penicillin-Streptomycin, purchased from...
Embodiment 3
[0091] Example 3. Preparation and preliminary screening of mesothelin monoclonal antibody
[0092] This part of the work was completed by Nanjing GenScript. The purified full-length mesothelin recombinant protein (hereinafter referred to as mesothelin antigen) obtained in Example 2 was used to immunize B6 / C57 mice according to standard methods. Fusion, screening, etc., obtained 9 monoclonal clones.
[0093] The corresponding cell lines of the fusion plate are 1G7-1, 3A11-1, 3F5-1, 6H12-2, 8C7-1, 8F8-2, 8G8-2, 11E2-2, 11H3-2, and the corresponding monoclonal antibodies are labeled with this .
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com