Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Reagent kit capable of simultaneously detecting virulent viruses and bacteria and detecting method

A kit, virus technology, applied in the field of virus detection and molecular biology

Pending Publication Date: 2019-06-07
HEFEI INSTITUTES OF PHYSICAL SCIENCE - CHINESE ACAD OF SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are no reports on kits and methods for the simultaneous detection of severe pathogenic microorganisms Ebola virus, Xinjiang hemorrhagic fever virus, Brucella and Bacillus anthracis. Kits for pathogenic microorganisms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent kit capable of simultaneously detecting virulent viruses and bacteria and detecting method
  • Reagent kit capable of simultaneously detecting virulent viruses and bacteria and detecting method
  • Reagent kit capable of simultaneously detecting virulent viruses and bacteria and detecting method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0093] Through the analysis of the conservation and specificity of the genome sequences of Ebola virus, Xinjiang hemorrhagic fever virus, Brucella and Bacillus anthracis, and through the screening of a large number of detection target genes and specific primers and probes, a high Primers and probes for specificity and amplification efficiency.

[0094] The present embodiment provides the combination of primers and probes for simultaneous detection of Ebola virus, Xinjiang hemorrhagic fever virus, Brucella and Bacillus anthracis, specifically as follows:

[0095] The specific primer sequence for detecting Ebola virus is shown in SEQ ID NO.5 and SEQ ID NO.6, and the probe sequence is shown in SEQ ID NO.13:

[0096] SEQ ID NO.5: GTGCGAATAACTATGAGGAAG;

[0097] SEQ ID NO. 6: TGATGCCCTTGCCCCCT;

[0098] SEQ ID NO. 13: GGTTTGTTTCAGAGCCATATCACCAAGA.

[0099] The specific primer sequences used to detect Xinjiang hemorrhagic fever virus are shown in SEQ ID NO.7 and SEQ ID NO.8, and ...

Embodiment 2

[0113] The present embodiment provides a kit for simultaneously detecting Ebola virus, Xinjiang hemorrhagic fever virus, Brucella and Bacillus anthracis, and the specific composition is as shown in Table 1:

[0114] Table 1 Composition of the kit (24T)

[0115]

[0116] Wherein, the composition of PCR reaction liquid is as follows: 50mM Tris-HCl, 75mM KCl, 3mM MgCl 2 , 10mM DTT, 2.5mM dUTP;

[0117] The concentration of the specific primer mixture for Ebola virus, Xinjiang hemorrhagic fever virus, Brucella and Bacillus anthracis is 50 μM;

[0118] The composition of the enzyme system is as follows: 0.1U / μl Hitaq hot-start DNA polymerase, 0.2U / μl UNG enzyme, 2.4U / μl super M-MLV reverse transcriptase, 0.32U / μl IRNasin RNase inhibitor.

[0119] In the above kit, the preparation method of virus-like particles containing Ebola virus NP gene and Xinjiang hemorrhagic fever virus S gene as a positive quality control is as follows:

[0120] (1) Download the genome sequences of Eb...

Embodiment 3

[0146] The present embodiment provides a kind of method that utilizes the kit that embodiment 2 provides to carry out Ebola virus, Xinjiang hemorrhagic fever virus, Brucella and Bacillus anthracis synchronous detection, comprising the steps:

[0147] (1) Sample collection and processing

[0148] Blood samples were collected in EDTA blood collection tubes and mixed thoroughly. Samples can be used for detection immediately; if not detected immediately, samples should be stored at 4°C for no more than 24 hours, -20°C for no more than 3 months, -70°C for long-term storage, and repeated freezing and thawing no more than 5 times.

[0149] (2) Extraction of sample nucleic acid

[0150] Use commercially available nucleic acid extraction kits, such as QIAampMinElute Virus Spin Kit from QIAGEN (Cat. No.: 57704), Viral Genomic DNA / RNA Extraction Kit from Tiangen Biochemical Technology Co., Ltd. (Cat. No.: DP315) or TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver.5.0 (Product No.: 9766...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a reagent kit capable of simultaneously detecting virulent viruses and bacteria and a detecting method. The reagent kit is mainly in accordance with 4 pathogenic microorganismsof ebola viruses, Sinkiang hemorrhagic fever viruses, Brucella and anthrax bacillus. The reagent kit comprises a specific primer probe combination for detecting the ebola viruses, the Sinkiang hemorrhagic fever viruses, the Brucella and the anthrax bacillus, a micro-fluidic solid-phase PCR chip on which a specificity probe is fixed, and an RNase-resistant high-stability positive quality control product consisting of virus-like particles containing viral nucleic acid and thalli containing plasmid carrying the specificity nucleic acid. According to the reagent kit, simultaneous detection of theebola viruses, the Sinkiang hemorrhagic fever viruses, the Brucella and the anthrax bacillus can be realized, and the reagent kit has the advantages of being high in detection flux, high in sensitivity, high in specificity, good in repeatability, short in detection time, low in detection cost, low in operation technique requirements, not liable to pollute and the like, and has great application prospects in the field of quick simultaneous detection of various pathogenic microorganisms.

Description

technical field [0001] The invention relates to the technical field of virus detection and molecular biology, in particular to a kit and a detection method for simultaneously detecting Ebola virus, Xinjiang hemorrhagic fever virus, Brucella and Bacillus anthracis. Background technique [0002] Vigorous pathogenic microorganisms can be divided into viruses, bacteria, actinomycetes, fungi, chlamydia, rickettsia and spirochetes according to their species sources, among which viruses and bacteria are the main ones: viruses such as Ebola virus , Xinjiang hemorrhagic fever virus (Crimea-Congo hemorrhagic fever virus) and Zika virus, etc.; bacteria such as Bacillus anthracis, Brucella, Burkholderia malliensis and Francisella tularensis. According to the research data of the World Health Organization (WHO), infectious diseases caused by potent pathogenic microorganisms are an important part of human morbidity and mortality, and are the main factors that threaten human health and cau...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/689C12Q1/686C12Q1/6834C12N15/11C12R1/01C12R1/07
Inventor 朱灿灿朱灵崔俊生赵俊杨柯汪磊邓国庆刘勇
Owner HEFEI INSTITUTES OF PHYSICAL SCIENCE - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com