Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A fully human anti-bcma chimeric antigen receptor and its application

A chimeric antigen receptor, fully human technology, applied in the field of tumor cell immunotherapy, can solve the problems of unpredictable treatment effect and unstable treatment effect.

Active Publication Date: 2020-04-24
GUANGZHOU BIO GENE TECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the development of technology, cells expressing chimeric antigen receptor (CAR) modifications have been used for treatment, but the therapeutic effect of the established antigen-binding domain used in CAR is unpredictable, resulting in unstable therapeutic effect
[0004] The use of BCMA antigens as ectodomains for the treatment of B cell-related diseases has been disclosed, but if the antigen-binding domain binds too strongly, then CAR T cells induce a large-scale release of cytokines, resulting in a potentially fatal disease that is regarded as a "cytokine storm". Immune response; however, if the antigen-binding domain binds too weakly, CAR T cells may not be sufficiently therapeutically effective in eradicating cancer cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A fully human anti-bcma chimeric antigen receptor and its application
  • A fully human anti-bcma chimeric antigen receptor and its application
  • A fully human anti-bcma chimeric antigen receptor and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0126] Example 1: Screening of scFv sequences against BCMA from a fully human scFv phage antibody library

[0127] In this example, the scFv sequence of BCMA was screened from the whole human scFv phage library. The source of the phage library: the PhaseII phage library was donated to Bio-Thera (Guangzhou) Biotechnology Co., Ltd. as a secondary library; the titer measured before screening was: 6.6 ×109pfu / ml, the total amount is 120μl, the diversity of the library is: 1×109pfu / ml, the specific steps are as follows:

[0128] 1) K562, cultivation, expansion and counting of K562-BCMA cells

[0129] (1) Culture of K562 and K562-BCMA cells: use IMDM medium (containing 10% FBS and 1 × penicillin and streptomycin) to cultivate, replace fresh medium by centrifugation every other day, and dilute the cell density to 1 × 106 cells / ml and then continued to culture, wherein K562-BCMA cells were screened with puromycin at a final concentration of 10 μg / ml during the culture process;

[01...

Embodiment 2

[0142] Example 2: Sequencing of the fully human anti-BCMA single-chain antibody (scFv) screened

[0143] The results of the Elisa test showed that 4 clones were positive (that is, the OD value at 450nm was more than 2 times greater than that of the control group). After sequencing, the 4 scFv sequences were shown in SEQ ID NO.33-36.

Embodiment 3

[0144] Example 3: Design of a fully human chimeric antigen receptor (CAR) against BCMA

[0145] The present invention constructs a fully human anti-BCMA chimeric antigen receptor, such as figure 1 As shown in the schematic diagram, the chimeric antigen receptor includes a signal peptide sequence (Leader) of CD8α, a single-chain antibody sequence (Anti-BCMA scFv) specifically binding to BCMA antigen, a hinge region (Hinge) of CD8α and Transmembrane region sequence (Transmembrane), 4-1BB co-stimulatory domain sequence and CD3ζ signaling domain sequence, the specific sequences of each part are as follows:

[0146] Amino acid sequence (SEQ ID NO.49) of CD8α signal peptide (leader): MALPVTALLLPLALLLLHAARP;

[0147] Nucleotide sequence (SEQ ID NO.50) of CD8α signal peptide (leader):

[0148] ATGGCACTGCCAGTGACAGCCCTGCTGCTGCCACTGGCCCTGCTGCTGCACGCAGCACGCCCT;

[0149] Amino acid sequence of CD8α hinge region (hinge) (SEQ ID NO.51):

[0150] TTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDF...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fully human anti-BCMA (B Cell Maturation Antigen) chimeric antigen receptor and application thereof. The chimeric antigen receptor comprises an extracellular domain, a membrane spanning domain and at least one intracellular domain capable of binding antigens, wherein the extracellular domain is an anti-BCMA single domain antibody; and the fully human anti-BCMA antibody comprises a heavy chain variable region and a light chain variable region having specific sequences. The chimeric antigen receptor disclosed by the invention has low immunogenicity, small rejection reaction and high safety, the solid tumor foci can be effectively reduced, and the tumor treatment effect is effectively improved.

Description

technical field [0001] The present invention relates to the field of tumor cell immunotherapy, in particular to a fully human anti-BCMA chimeric antigen receptor and its application, specifically the fully human chimeric antigen receptor T (CAR-T) cell technology construction method and its application in anti-tumor therapy. Background technique [0002] With the development of tumor immunology theory and clinical technology, chimeric antigen receptor T-cell immunotherapy (CAR-T) has become one of the most promising tumor immunotherapy. Generally, a chimeric antigen receptor CAR consists of a tumor-associated antigen-binding region, an extracellular hinge region, a transmembrane region, and an intracellular signal transduction region. Usually, CAR contains the single chain fragment variable region (Single chain fragment variable, scFv) of the antibody or the binding domain specific to the tumor associated antigen (tumor associated antigen, TAA), which communicates with the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N5/10C12N7/01A61K35/17A61P35/00A61P35/02
CPCA61K35/17A61P35/00A61P35/02C07K14/7051C07K16/2878C07K2317/622C07K2319/02C07K2319/33C12N7/00C12N15/86C12N2510/00C12N2740/15021C12N2740/15043
Inventor 李光超郭锦涛丁雯邱玉信罗敏莫文俊
Owner GUANGZHOU BIO GENE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com