Fully human anti-BCMA (B Cell Maturation Antigen) chimeric antigen receptor and application thereof
A chimeric antigen receptor, fully human technology, applied in the field of cellular immunotherapy of tumors, can solve the problems of unstable treatment effect and unpredictable treatment effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0126] Example 1: Screening of scFv sequences against BCMA from a fully human scFv phage antibody library
[0127] In this example, the scFv sequence of BCMA was screened from the whole human scFv phage library. The source of the phage library: the PhaseII phage library was donated to Bio-Thera (Guangzhou) Biotechnology Co., Ltd. as a secondary library; the titer measured before screening was: 6.6 ×109pfu / ml, the total amount is 120μl, the diversity of the library is: 1×109pfu / ml, the specific steps are as follows:
[0128] 1) K562, cultivation, expansion and counting of K562-BCMA cells
[0129] (1) Culture of K562 and K562-BCMA cells: use IMDM medium (containing 10% FBS and 1 × penicillin and streptomycin) to cultivate, replace fresh medium by centrifugation every other day, and dilute the cell density to 1 × 106 cells / ml and then continued to culture, wherein K562-BCMA cells were screened with puromycin at a final concentration of 10 μg / ml during the culture process;
[01...
Embodiment 2
[0142] Example 2: Sequencing of the fully human anti-BCMA single-chain antibody (scFv) screened
[0143] The results of the Elisa test showed that 4 clones were positive (that is, the OD value at 450nm was more than 2 times greater than that of the control group). After sequencing, the 4 scFv sequences were shown in SEQ ID NO.33-36.
Embodiment 3
[0144] Example 3: Design of a fully human chimeric antigen receptor (CAR) against BCMA
[0145] The present invention constructs a fully human anti-BCMA chimeric antigen receptor, such as figure 1 As shown in the schematic diagram, the chimeric antigen receptor includes a signal peptide sequence (Leader) of CD8α, a single-chain antibody sequence (Anti-BCMA scFv) specifically binding to BCMA antigen, a hinge region (Hinge) of CD8α and Transmembrane region sequence (Transmembrane), 4-1BB co-stimulatory domain sequence and CD3ζ signaling domain sequence, the specific sequences of each part are as follows:
[0146] Amino acid sequence (SEQ ID NO.49) of CD8α signal peptide (leader): MALPVTALLLPLALLLLHAARP;
[0147] Nucleotide sequence (SEQ ID NO.50) of CD8α signal peptide (leader):
[0148] ATGGCACTGCCAGTGACAGCCCTGCTGCTGCCACTGGCCCTGCTGCTGCACGCAGCACGCCCT;
[0149] Amino acid sequence of CD8α hinge region (hinge) (SEQ ID NO.51):
[0150] TTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDF...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap